trnav-cac-22



Basic Information


Item Value
gene id trnav-cac-22
gene name NA
gene type misc
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52503689 ~ 52600136 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnav-cac-22
gtttccgtagtgtagtggttatcacgttcgcctcacacgcgaaaggtccccggttcgaaaccgggcggaaaca
>TU819447
acccttagttttccagtCattcggtttccgtagtgtagtggttatcacgttcgcctcacacgcgaaaggtccccggttcgaaaccgggcggaaacattttgtaattttcaatatttcccaatgcccagaggctagcatttggtttgaaacagttgaggtttgtctaaaccttactgtctacctctccgacctgtggatcaatgttgccgttttttgggggacctccaccatgagatctgtatgaatgtgaccagactgacagcttctctgagccaggcaaattcatttatcagggtcattgtaatggatatatccaaagaaatggcaatataatccaaggtaaaacaaacaaaaatgtagatcgttttctgtcatttcagctgcttgatgtgattgtgtgatagatttagttggctggctagcaaaggaaaagaagctagcctgcataggtacagtgcattcggaaagttttcagaccccttacatttttc

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnav-cac-22 False 73 mRNA 0.56 1 52504084 52504156
TU819447 True 491 lncRNA 0.43 2 52503689 52600136
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-aac-23 NA coding downstream 899 52503113 ~ 52503185 (-)
trnav-cac-21 NA coding downstream 1101 52502911 ~ 52502983 (-)
trnav-aac-22 NA coding downstream 2072 52501940 ~ 52502012 (-)
trnav-cac-20 NA coding downstream 2274 52501738 ~ 52501810 (-)
trnav-aac-21 NA coding downstream 3245 52500767 ~ 52500839 (-)
trnav-aac-24 NA coding upstream 130 52504286 ~ 52504358 (-)
trnav-aac-25 NA coding upstream 549 52504705 ~ 52504777 (-)
trnav-aac-26 NA coding upstream 1848 52506004 ~ 52506076 (-)
trnav-aac-27 NA coding upstream 4120 52508276 ~ 52508348 (-)
trnav-aac-28 NA coding upstream 4321 52508477 ~ 52508549 (-)
G721235 NA non-coding downstream 13681 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 44425 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 94856 52408868 ~ 52409228 (-)
G721149 LOC100136012 non-coding downstream 211739 52291980 ~ 52292345 (-)
G721148 NA non-coding downstream 212164 52291672 ~ 52291920 (-)
G721243 NA non-coding upstream 24247 52528403 ~ 52589826 (-)
G721245 NA non-coding upstream 29053 52533209 ~ 52668446 (-)
G721248 NA non-coding upstream 35924 52540080 ~ 52545734 (-)
G721238 NA non-coding upstream 85063 52589219 ~ 52656589 (-)
G721260 NA non-coding upstream 215130 52719286 ~ 52726784 (-)
LOC110530043 LOC106568739 other downstream 1245065 51252355 ~ 51259061 (-)
G719151 NA other downstream 1564613 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2614832 49866272 ~ 49937001 (-)
G718489 NA other downstream 2666388 49785674 ~ 49837696 (-)
G716488 NA other downstream 3715122 48788521 ~ 48788962 (-)
G721275 NA other upstream 256883 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 959026 53462034 ~ 53478913 (-)
G722459 NA other upstream 993992 53495804 ~ 53499730 (-)
G722602 NA other upstream 1299287 53803443 ~ 53856065 (-)
G722670 NA other upstream 1422072 53926228 ~ 53927959 (-)
trnav-aac-90 NA coding upstream 107 52600243 ~ 52600315 (-)
trnav-aac-91 NA coding upstream 2916 52603052 ~ 52603124 (-)
trnav-aac-92 NA coding upstream 4424 52604560 ~ 52604632 (-)
trnav-cac-33 NA coding upstream 5730 52605866 ~ 52605938 (-)
trnav-aac-93 NA coding upstream 5932 52606068 ~ 52606140 (-)
G721288 NA non-coding upstream 178242 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 178900 52779036 ~ 52779473 (-)
selenof sep15 non-coding upstream 193181 52793317 ~ 52818726 (-)
G721414 NA non-coding upstream 374661 52974797 ~ 52977530 (-)

Expression


trnav-cac-22 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

trnav-cac-22 Expression in each Bioproject

Bar chart with 6 bars.
trnav-cac-22 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network