trnav-aac-24


Basic Information

Item Value
gene id trnav-aac-24
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52504286 ~ 52504358 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>trnav-aac-24
gtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccccggttcgagaccgggcggaaaca

Function

NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
trnav-aac-24 True 73 mRNA 0.56 1 52504286 52504358
Loading

Neighbor

gene id symbol gene type direction distance location
trnav-cac-22 NA coding downstream 130 52503689 ~ 52600136 (-)
trnav-aac-23 NA coding downstream 1101 52503113 ~ 52503185 (-)
trnav-cac-21 NA coding downstream 1303 52502911 ~ 52502983 (-)
trnav-aac-22 NA coding downstream 2274 52501940 ~ 52502012 (-)
trnav-cac-20 NA coding downstream 2476 52501738 ~ 52501810 (-)
trnav-aac-25 NA coding upstream 347 52504705 ~ 52504777 (-)
trnav-aac-26 NA coding upstream 1646 52506004 ~ 52506076 (-)
trnav-aac-27 NA coding upstream 3918 52508276 ~ 52508348 (-)
trnav-aac-28 NA coding upstream 4119 52508477 ~ 52508549 (-)
trnav-cac-23 NA coding upstream 5090 52509448 ~ 52509520 (-)
G721235 NA non-coding downstream 13883 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 44627 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 95058 52408868 ~ 52409228 (-)
G721149 LOC100136012 non-coding downstream 211941 52291980 ~ 52292345 (-)
G721148 NA non-coding downstream 212366 52291672 ~ 52291920 (-)
G721243 NA non-coding upstream 24045 52528403 ~ 52589826 (-)
G721245 NA non-coding upstream 28851 52533209 ~ 52668446 (-)
G721248 NA non-coding upstream 35722 52540080 ~ 52545734 (-)
G721238 NA non-coding upstream 84861 52589219 ~ 52656589 (-)
G721260 NA non-coding upstream 214928 52719286 ~ 52726784 (-)
LOC110530043 LOC106568739 other downstream 1245267 51252355 ~ 51259061 (-)
G719151 NA other downstream 1564815 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2615034 49866272 ~ 49937001 (-)
G718489 NA other downstream 2666590 49785674 ~ 49837696 (-)
G716488 NA other downstream 3715324 48788521 ~ 48788962 (-)
G721275 NA other upstream 256681 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 958824 53462034 ~ 53478913 (-)
G722459 NA other upstream 993790 53495804 ~ 53499730 (-)
G722602 NA other upstream 1299085 53803443 ~ 53856065 (-)
G722670 NA other upstream 1421870 53926228 ~ 53927959 (-)

Expression

trnav-aac-24 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network