trnav-aac-28


Basic Information

Item Value
gene id trnav-aac-28
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52508477 ~ 52508549 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>trnav-aac-28
gtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccctggttcgagaccgggcggaaaca

Function

NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
trnav-aac-28 True 73 mRNA 0.56 1 52508477 52508549
Loading

Neighbor

gene id symbol gene type direction distance location
trnav-aac-27 NA coding downstream 129 52508276 ~ 52508348 (-)
trnav-aac-26 NA coding downstream 2401 52506004 ~ 52506076 (-)
trnav-aac-25 NA coding downstream 3700 52504705 ~ 52504777 (-)
trnav-aac-24 NA coding downstream 4119 52504286 ~ 52504358 (-)
trnav-cac-22 NA coding downstream 4321 52503689 ~ 52600136 (-)
trnav-cac-23 NA coding upstream 899 52509448 ~ 52509520 (-)
trnav-aac-29 NA coding upstream 3228 52511777 ~ 52511849 (-)
trnav-aac-30 NA coding upstream 6269 52514818 ~ 52514890 (-)
trnav-aac-31 NA coding upstream 6597 52515146 ~ 52515218 (-)
trnav-aac-32 NA coding upstream 6799 52515348 ~ 52515420 (-)
G721235 NA non-coding downstream 18074 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 48818 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 99249 52408868 ~ 52409228 (-)
G721149 LOC100136012 non-coding downstream 216132 52291980 ~ 52292345 (-)
G721148 NA non-coding downstream 216557 52291672 ~ 52291920 (-)
G721243 NA non-coding upstream 19854 52528403 ~ 52589826 (-)
G721245 NA non-coding upstream 24660 52533209 ~ 52668446 (-)
G721248 NA non-coding upstream 31531 52540080 ~ 52545734 (-)
G721238 NA non-coding upstream 80670 52589219 ~ 52656589 (-)
G721260 NA non-coding upstream 210737 52719286 ~ 52726784 (-)
LOC110530043 LOC106568739 other downstream 1249458 51252355 ~ 51259061 (-)
G719151 NA other downstream 1569006 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2619225 49866272 ~ 49937001 (-)
G718489 NA other downstream 2670781 49785674 ~ 49837696 (-)
G716488 NA other downstream 3719515 48788521 ~ 48788962 (-)
G721275 NA other upstream 252490 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 954633 53462034 ~ 53478913 (-)
G722459 NA other upstream 989599 53495804 ~ 53499730 (-)
G722602 NA other upstream 1294894 53803443 ~ 53856065 (-)
G722670 NA other upstream 1417679 53926228 ~ 53927959 (-)

Expression

trnav-aac-28 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network