trnav-uac-6



Basic Information


Item Value
gene id trnav-uac-6
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52532743 ~ 52532815 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnav-uac-6
gtttccgtagtgtagtggttatcacgttcgccttacacgcgaaaggtccccagttcgagaccgggcggaaaca

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnav-uac-6 True 73 mRNA 0.51 1 52532743 52532815
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-uac-5 NA coding downstream 130 52532541 ~ 52532613 (-)
trnav-cac-25 NA coding downstream 315 52532356 ~ 52532428 (-)
trnav-aac-47 NA coding downstream 1285 52531386 ~ 52531458 (-)
trnav-aac-46 NA coding downstream 1487 52531184 ~ 52531256 (-)
trnav-cac-24 NA coding downstream 1672 52530999 ~ 52531071 (-)
trnav-aac-48 NA coding upstream 1360 52534175 ~ 52534247 (-)
trnav-aac-49 NA coding upstream 3204 52536019 ~ 52536091 (-)
trnav-aac-50 NA coding upstream 5359 52538174 ~ 52538246 (-)
trnav-aac-51 NA coding upstream 5558 52538373 ~ 52538445 (-)
trnav-aac-52 NA coding upstream 7063 52539878 ~ 52539950 (-)
G721235 NA non-coding downstream 42340 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 73084 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 123515 52408868 ~ 52409228 (-)
G721149 LOC100136012 non-coding downstream 240398 52291980 ~ 52292345 (-)
G721148 NA non-coding downstream 240823 52291672 ~ 52291920 (-)
G721245 NA non-coding upstream 394 52533209 ~ 52668446 (-)
G721248 NA non-coding upstream 7265 52540080 ~ 52545734 (-)
G721238 NA non-coding upstream 56404 52589219 ~ 52656589 (-)
G721260 NA non-coding upstream 186471 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 245563 52778378 ~ 52778596 (-)
LOC110530043 LOC106568739 other downstream 1273724 51252355 ~ 51259061 (-)
G719151 NA other downstream 1593272 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2643491 49866272 ~ 49937001 (-)
G718489 NA other downstream 2695047 49785674 ~ 49837696 (-)
G716488 NA other downstream 3743781 48788521 ~ 48788962 (-)
G721275 NA other upstream 228224 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 930367 53462034 ~ 53478913 (-)
G722459 NA other upstream 965333 53495804 ~ 53499730 (-)
G722602 NA other upstream 1270628 53803443 ~ 53856065 (-)
G722670 NA other upstream 1393413 53926228 ~ 53927959 (-)

Expression


trnav-uac-6 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network