trnav-aac-51



Basic Information


Item Value
gene id trnav-aac-51
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52538373 ~ 52538445 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnav-aac-51
gtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggaccccggttcgagaccgggcggaaaca

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnav-aac-51 True 73 mRNA 0.56 1 52538373 52538445
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-aac-50 NA coding downstream 127 52538174 ~ 52538246 (-)
trnav-aac-49 NA coding downstream 2282 52536019 ~ 52536091 (-)
trnav-aac-48 NA coding downstream 4126 52534175 ~ 52534247 (-)
trnav-uac-6 NA coding downstream 5558 52532743 ~ 52532815 (-)
trnav-uac-5 NA coding downstream 5760 52532541 ~ 52532613 (-)
trnav-aac-52 NA coding upstream 1433 52539878 ~ 52539950 (-)
trnav-aac-53 NA coding upstream 3588 52542033 ~ 52542105 (-)
trnav-aac-54 NA coding upstream 4996 52543441 ~ 52543513 (-)
trnav-aac-55 NA coding upstream 6503 52544948 ~ 52545020 (-)
trnav-aac-56 NA coding upstream 8658 52547103 ~ 52547175 (-)
G721237 NA non-coding downstream 34 52485609 ~ 52538339 (-)
G721235 NA non-coding downstream 47970 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 78714 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 129145 52408868 ~ 52409228 (-)
G721149 LOC100136012 non-coding downstream 246028 52291980 ~ 52292345 (-)
G721248 NA non-coding upstream 1635 52540080 ~ 52545734 (-)
G721238 NA non-coding upstream 50774 52589219 ~ 52656589 (-)
G721260 NA non-coding upstream 180841 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 239933 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 240591 52779036 ~ 52779473 (-)
LOC110530043 LOC106568739 other downstream 1279354 51252355 ~ 51259061 (-)
G719151 NA other downstream 1598902 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2649121 49866272 ~ 49937001 (-)
G718489 NA other downstream 2700677 49785674 ~ 49837696 (-)
G716488 NA other downstream 3749411 48788521 ~ 48788962 (-)
G721275 NA other upstream 222594 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 924737 53462034 ~ 53478913 (-)
G722459 NA other upstream 959703 53495804 ~ 53499730 (-)
G722602 NA other upstream 1264998 53803443 ~ 53856065 (-)
G722670 NA other upstream 1387783 53926228 ~ 53927959 (-)

Expression


trnav-aac-51 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network