trnav-aac-80



Basic Information


Item Value
gene id trnav-aac-80
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52586514 ~ 52586586 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnav-aac-80
gtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccccggttcgagaccgggcggaaaca

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnav-aac-80 True 73 mRNA 0.56 1 52586514 52586586
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-aac-79 NA coding downstream 1210 52585232 ~ 52585304 (-)
trnav-uac-13 NA coding downstream 1412 52585030 ~ 52585102 (-)
trnav-aac-78 NA coding downstream 2492 52583950 ~ 52584022 (-)
trnav-uac-12 NA coding downstream 2694 52583748 ~ 52583820 (-)
trnav-aac-77 NA coding downstream 3774 52582668 ~ 52582740 (-)
trnav-aac-81 NA coding upstream 1435 52588021 ~ 52588093 (-)
trnav-aac-82 NA coding upstream 2943 52589529 ~ 52589601 (-)
trnav-aac-83 NA coding upstream 4107 52590693 ~ 52590765 (-)
trnav-cac-30 NA coding upstream 5078 52591664 ~ 52591736 (-)
trnav-aac-84 NA coding upstream 5280 52591866 ~ 52591938 (-)
G721248 NA non-coding downstream 40780 52540080 ~ 52545734 (-)
G721237 NA non-coding downstream 48175 52485609 ~ 52538339 (-)
G721235 NA non-coding downstream 96111 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 126855 52448383 ~ 52459659 (-)
G721203 NA non-coding downstream 177286 52408868 ~ 52409228 (-)
G721238 NA non-coding upstream 2633 52589219 ~ 52656589 (-)
G721260 NA non-coding upstream 132700 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 191792 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 192450 52779036 ~ 52779473 (-)
selenof sep15 non-coding upstream 206731 52793317 ~ 52818726 (-)
LOC110530043 LOC106568739 other downstream 1327495 51252355 ~ 51259061 (-)
G719151 NA other downstream 1647043 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2697262 49866272 ~ 49937001 (-)
G718489 NA other downstream 2748818 49785674 ~ 49837696 (-)
G716488 NA other downstream 3797552 48788521 ~ 48788962 (-)
G721275 NA other upstream 174453 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 876596 53462034 ~ 53478913 (-)
G722459 NA other upstream 911562 53495804 ~ 53499730 (-)
G722602 NA other upstream 1216857 53803443 ~ 53856065 (-)
G722670 NA other upstream 1339642 53926228 ~ 53927959 (-)

Expression


trnav-aac-80 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network