trnav-aac-84


Basic Information

Item Value
gene id trnav-aac-84
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52591866 ~ 52591938 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>trnav-aac-84
gtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccctggttcgagaccgggcggaaaca

Function

NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
trnav-aac-84 True 73 mRNA 0.55 1 52591866 52591938

Neighbor

gene id symbol gene type direction distance location
trnav-cac-30 NA coding downstream 130 52591664 ~ 52591736 (-)
trnav-aac-83 NA coding downstream 1101 52590693 ~ 52590765 (-)
trnav-aac-82 NA coding downstream 2265 52589529 ~ 52589601 (-)
trnav-aac-81 NA coding downstream 3773 52588021 ~ 52588093 (-)
trnav-aac-80 NA coding downstream 5280 52586514 ~ 52586586 (-)
trnav-aac-85 NA coding upstream 1101 52593039 ~ 52593111 (-)
trnav-aac-86 NA coding upstream 2274 52594212 ~ 52594284 (-)
trnav-cac-31 NA coding upstream 3245 52595183 ~ 52595255 (-)
trnav-aac-87 NA coding upstream 3447 52595385 ~ 52595457 (-)
trnav-aac-88 NA coding upstream 5289 52597227 ~ 52597299 (-)
G721243 NA non-coding downstream 2040 52528403 ~ 52589826 (-)
G721248 NA non-coding downstream 46132 52540080 ~ 52545734 (-)
G721237 NA non-coding downstream 53527 52485609 ~ 52538339 (-)
G721235 NA non-coding downstream 101463 52483522 ~ 52490403 (-)
G721207 LOC106584099 non-coding downstream 132207 52448383 ~ 52459659 (-)
G721260 NA non-coding upstream 127348 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 186440 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 187098 52779036 ~ 52779473 (-)
selenof sep15 non-coding upstream 201379 52793317 ~ 52818726 (-)
G721414 NA non-coding upstream 382859 52974797 ~ 52977530 (-)
LOC110530043 LOC106568739 other downstream 1332847 51252355 ~ 51259061 (-)
G719151 NA other downstream 1652395 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2702614 49866272 ~ 49937001 (-)
G718489 NA other downstream 2754170 49785674 ~ 49837696 (-)
G716488 NA other downstream 3802904 48788521 ~ 48788962 (-)
G721275 NA other upstream 169101 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 871244 53462034 ~ 53478913 (-)
G722459 NA other upstream 906210 53495804 ~ 53499730 (-)
G722602 NA other upstream 1211505 53803443 ~ 53856065 (-)
G722670 NA other upstream 1334290 53926228 ~ 53927959 (-)

Expression

trnav-aac-84 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network