trnav-aac-91



Basic Information


Item Value
gene id trnav-aac-91
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52603052 ~ 52603124 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnav-aac-91
gtttccgtagtgtagttgttatcacgttcgcctaacacgcgaaaggtccccgtttcgagaccgggcggaaaca

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnav-aac-91 True 73 mRNA 0.53 1 52603052 52603124
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-aac-90 NA coding downstream 2737 52600243 ~ 52600315 (-)
trnav-cac-32 NA coding downstream 2939 52600041 ~ 52600113 (-)
trnav-aac-89 NA coding downstream 4245 52598735 ~ 52598807 (-)
trnav-aac-88 NA coding downstream 5753 52597227 ~ 52597299 (-)
trnav-aac-87 NA coding downstream 7595 52595385 ~ 52595457 (-)
trnav-aac-92 NA coding upstream 1436 52604560 ~ 52604632 (-)
trnav-cac-33 NA coding upstream 2742 52605866 ~ 52605938 (-)
trnav-aac-93 NA coding upstream 2944 52606068 ~ 52606140 (-)
trnav-aac-94 NA coding upstream 4092 52607216 ~ 52607288 (-)
trnav-aac-95 NA coding upstream 5259 52608383 ~ 52608455 (-)
trnav-cac-22 NA non-coding downstream 2916 52503689 ~ 52600136 (-)
G721236 NA non-coding downstream 11096 52484057 ~ 52591956 (-)
G721243 NA non-coding downstream 13226 52528403 ~ 52589826 (-)
G721248 NA non-coding downstream 57318 52540080 ~ 52545734 (-)
G721237 NA non-coding downstream 64713 52485609 ~ 52538339 (-)
G721260 NA non-coding upstream 116162 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 175254 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 175912 52779036 ~ 52779473 (-)
selenof sep15 non-coding upstream 190193 52793317 ~ 52818726 (-)
G721414 NA non-coding upstream 371673 52974797 ~ 52977530 (-)
LOC110530043 LOC106568739 other downstream 1344033 51252355 ~ 51259061 (-)
G719151 NA other downstream 1663581 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2713800 49866272 ~ 49937001 (-)
G718489 NA other downstream 2765356 49785674 ~ 49837696 (-)
G716488 NA other downstream 3814090 48788521 ~ 48788962 (-)
G721275 NA other upstream 157915 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 860058 53462034 ~ 53478913 (-)
G722459 NA other upstream 895024 53495804 ~ 53499730 (-)
G722602 NA other upstream 1200319 53803443 ~ 53856065 (-)
G722670 NA other upstream 1323104 53926228 ~ 53927959 (-)

Expression


trnav-aac-91 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network