trnav-aac-135


Basic Information

Item Value
gene id trnav-aac-135
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52670727 ~ 52670799 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>trnav-aac-135
gtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccccggttcgagaccgggcggaaaca

Function

NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
trnav-aac-135 True 73 mRNA 0.56 1 52670727 52670799
Loading

Neighbor

gene id symbol gene type direction distance location
trnav-aac-134 NA coding downstream 1410 52669245 ~ 52669317 (-)
trnav-aac-133 NA coding downstream 2892 52667761 ~ 52667835 (-)
trnav-aac-132 NA coding downstream 4325 52666330 ~ 52666402 (-)
trnav-cac-45 NA coding downstream 5807 52664848 ~ 52664920 (-)
trnav-cac-44 NA coding downstream 6009 52664646 ~ 52664718 (-)
trnav-cac-46 NA coding upstream 1234 52672033 ~ 52672105 (-)
trnav-aac-136 NA coding upstream 1436 52672235 ~ 52672307 (-)
trnav-cac-47 NA coding upstream 2742 52673541 ~ 52673613 (-)
trnav-aac-137 NA coding upstream 2944 52673743 ~ 52673815 (-)
trnav-aac-138 NA coding upstream 4375 52675174 ~ 52675246 (-)
G721245 NA non-coding downstream 2281 52533209 ~ 52668446 (-)
G721238 NA non-coding downstream 14138 52589219 ~ 52656589 (-)
trnav-cac-22 NA non-coding downstream 70591 52503689 ~ 52600136 (-)
G721236 NA non-coding downstream 78771 52484057 ~ 52591956 (-)
G721260 NA non-coding upstream 48487 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 107579 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 108237 52779036 ~ 52779473 (-)
selenof sep15 non-coding upstream 122518 52793317 ~ 52818726 (-)
G721414 NA non-coding upstream 303998 52974797 ~ 52977530 (-)
LOC110530043 LOC106568739 other downstream 1411708 51252355 ~ 51259061 (-)
G719151 NA other downstream 1731256 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2781475 49866272 ~ 49937001 (-)
G718489 NA other downstream 2833031 49785674 ~ 49837696 (-)
G716488 NA other downstream 3881765 48788521 ~ 48788962 (-)
G721275 NA other upstream 90240 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 792383 53462034 ~ 53478913 (-)
G722459 NA other upstream 827349 53495804 ~ 53499730 (-)
G722602 NA other upstream 1132644 53803443 ~ 53856065 (-)
G722670 NA other upstream 1255429 53926228 ~ 53927959 (-)

Expression

trnav-aac-135 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network