trnav-aac-149


Basic Information

Item Value
gene id trnav-aac-149
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52717273 ~ 52717345 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>trnav-aac-149
gtttccgtagtgtagtggttatcacgttcgcctaacacgcgaaaggtccccgtttcgagaccgggcggaaaca

Function

NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
trnav-aac-149 True 73 mRNA 0.55 1 52717273 52717345
Loading

Neighbor

gene id symbol gene type direction distance location
trnav-aac-148 NA coding downstream 1101 52716100 ~ 52716172 (-)
trnav-cac-78 NA coding downstream 1303 52715898 ~ 52715970 (-)
trnav-aac-147 NA coding downstream 2274 52714927 ~ 52714999 (-)
trnav-aac-146 NA coding downstream 3447 52713754 ~ 52713826 (-)
trnav-cac-77 NA coding downstream 3649 52713552 ~ 52713624 (-)
trnav-cac-79 NA coding upstream 899 52718244 ~ 52718316 (-)
trnav-aac-150 NA coding upstream 1101 52718446 ~ 52718518 (-)
trnav-aac-151 NA coding upstream 2602 52719947 ~ 52720019 (-)
trnav-cac-80 NA coding upstream 3908 52721253 ~ 52721325 (-)
trnav-cac-81 NA coding upstream 5214 52722559 ~ 52722631 (-)
G721245 NA non-coding downstream 48827 52533209 ~ 52668446 (-)
G721238 NA non-coding downstream 60684 52589219 ~ 52656589 (-)
trnav-cac-22 NA non-coding downstream 117137 52503689 ~ 52600136 (-)
G721236 NA non-coding downstream 125317 52484057 ~ 52591956 (-)
G721260 NA non-coding upstream 1941 52719286 ~ 52726784 (-)
G721288 NA non-coding upstream 61033 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 61691 52779036 ~ 52779473 (-)
selenof sep15 non-coding upstream 75972 52793317 ~ 52818726 (-)
G721414 NA non-coding upstream 257452 52974797 ~ 52977530 (-)
LOC110530043 LOC106568739 other downstream 1458254 51252355 ~ 51259061 (-)
G719151 NA other downstream 1777802 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2828021 49866272 ~ 49937001 (-)
G718489 NA other downstream 2879577 49785674 ~ 49837696 (-)
G716488 NA other downstream 3928311 48788521 ~ 48788962 (-)
G721275 NA other upstream 43694 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 745837 53462034 ~ 53478913 (-)
G722459 NA other upstream 780803 53495804 ~ 53499730 (-)
G722602 NA other upstream 1086098 53803443 ~ 53856065 (-)
G722670 NA other upstream 1208883 53926228 ~ 53927959 (-)

Expression

trnav-aac-149 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network