trnav-cac-83



Basic Information


Item Value
gene id trnav-cac-83
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52725373 ~ 52725445 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>trnav-cac-83
gtttccgtagtgtagtggttatcacgttcgcctcacacgcggaaggtccccggttcgaaaccgggtggaaaca

Function


NR:

description
PREDICTED: interferon-induced protein 44-like isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
trnav-cac-83 True 73 mRNA 0.56 1 52725373 52725445
Loading

Neighbor


gene id symbol gene type direction distance location
trnav-aac-152 NA coding downstream 1234 52724067 ~ 52724139 (-)
trnav-cac-82 NA coding downstream 1436 52723865 ~ 52723937 (-)
trnav-cac-81 NA coding downstream 2742 52722559 ~ 52722631 (-)
trnav-cac-80 NA coding downstream 4048 52721253 ~ 52721325 (-)
trnav-aac-151 NA coding downstream 5354 52719947 ~ 52720019 (-)
trnav-cac-84 NA coding upstream 1513 52726958 ~ 52727030 (-)
trnav-cac-85 NA coding upstream 4453 52729898 ~ 52729970 (-)
LOC110530084 LOC106568816 coding upstream 7565 52733010 ~ 52756602 (-)
selenof sep15 coding upstream 68300 52793317 ~ 52818726 (-)
LOC110530090 LOC106568989 coding upstream 180922 52906367 ~ 52917437 (-)
G721245 NA non-coding downstream 56927 52533209 ~ 52668446 (-)
G721238 NA non-coding downstream 68784 52589219 ~ 52656589 (-)
trnav-cac-22 NA non-coding downstream 125237 52503689 ~ 52600136 (-)
G721236 NA non-coding downstream 133417 52484057 ~ 52591956 (-)
G721288 NA non-coding upstream 52933 52778378 ~ 52778596 (-)
G721289 NA non-coding upstream 53591 52779036 ~ 52779473 (-)
G721414 NA non-coding upstream 249352 52974797 ~ 52977530 (-)
G721425 LOC106568985 non-coding upstream 261472 52986917 ~ 52989556 (-)
LOC110530043 LOC106568739 other downstream 1466354 51252355 ~ 51259061 (-)
G719151 NA other downstream 1785902 50936928 ~ 50939471 (-)
LOC110530011 LOC106568709 other downstream 2836121 49866272 ~ 49937001 (-)
G718489 NA other downstream 2887677 49785674 ~ 49837696 (-)
G716488 NA other downstream 3936411 48788521 ~ 48788962 (-)
G721275 NA other upstream 35594 52761039 ~ 52761451 (-)
LOC110529122 LOC106568971 other upstream 737737 53462034 ~ 53478913 (-)
G722459 NA other upstream 772703 53495804 ~ 53499730 (-)
G722602 NA other upstream 1077998 53803443 ~ 53856065 (-)
G722670 NA other upstream 1200783 53926228 ~ 53927959 (-)

Expression


trnav-cac-83 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

trnav-cac-83 Expression in each Bioproject

Bar chart with 1 bar.
trnav-cac-83 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1.25.
End of interactive chart.

Co-expression Network