LOC118965682



Basic Information


Item Value
gene id LOC118965682
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54002434 ~ 54002567 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005053060.1
TTGCATTGTGGTATGTCGGTGAAAGCTCAGCTTTTACCGTGAGTGTATCCAACATACCAATGCTAAATGAACCCCATCTTGCAGAAGGGTGAAAGTCTGTGGCAGTGGCACTCTTTCGAAAGTTGGGTACATTT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005053060.1 True 134 mRNA 0.45 1 54002434 54002567
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530121 LOC106568956 coding downstream 7130 53965997 ~ 53995304 (-)
insl3 NA coding downstream 84817 53914820 ~ 53917617 (-)
LOC110530934 LOC106568959 coding downstream 121649 53818706 ~ 53880785 (-)
ocel1 LOC106568960 coding downstream 190242 53806663 ~ 53812192 (-)
plvapa LOC106568963 coding downstream 273763 53722172 ~ 53728671 (-)
cnn2 cnn2 coding upstream 5867 54008434 ~ 54014434 (-)
crsp7 LOC106568954 coding upstream 22169 54024736 ~ 54039572 (-)
LOC110530125 LOC106568953 coding upstream 55555 54058122 ~ 54105410 (-)
LOC110530126 LOC106569003 coding upstream 124501 54127068 ~ 54131739 (-)
LOC110530134 LOC106568945 coding upstream 371666 54374233 ~ 54377574 (-)
G722699 NA non-coding downstream 37027 53965176 ~ 53965407 (-)
G722696 NA non-coding downstream 48005 53954197 ~ 53954429 (-)
G722694 NA non-coding downstream 50034 53952195 ~ 53952400 (-)
G722686 NA non-coding downstream 57488 53944594 ~ 53944946 (-)
G722659 NA non-coding downstream 96972 53905148 ~ 53905462 (-)
G722728 NA non-coding upstream 30724 54033291 ~ 54034722 (-)
G722805 LOC106568951 non-coding upstream 177875 54180442 ~ 54185532 (-)
G722812 NA non-coding upstream 185502 54188069 ~ 54189214 (-)
G722814 NA non-coding upstream 186825 54189392 ~ 54243058 (-)
G722773 LOC106568951 non-coding upstream 202121 54204688 ~ 54207815 (-)
G722670 NA other downstream 74475 53926228 ~ 53927959 (-)
G722602 NA other downstream 146369 53803443 ~ 53856065 (-)
G722459 NA other downstream 502704 53495804 ~ 53499730 (-)
LOC110529122 LOC106568971 other downstream 538670 53462034 ~ 53478913 (-)
G721275 NA other downstream 1240983 52761039 ~ 52761451 (-)
G722761 NA other upstream 121812 54124379 ~ 54139341 (-)
G722854 NA other upstream 248547 54251114 ~ 54251546 (-)
G722864 LOC106581475 other upstream 279118 54281685 ~ 54281978 (-)
G723955 NA other upstream 1374714 55377281 ~ 55377776 (-)
G723966 NA other upstream 1394057 55396624 ~ 55396885 (-)

Expression


LOC118965682 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

LOC118965682 Expression in each Bioproject

Bar chart with 12 bars.
LOC118965682 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network