LOC110530139 (LOC100194659)


Basic Information

Item Value
gene id LOC110530139
gene name LOC100194659
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54443130 ~ 54445222 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XM_021612981.2
ATCCCAATTTGCAATCCTTTCATGTCTGGTGGTCAAGGCGCCAAGAATCCTCCAGACCAGTAGATGGCGATAACTGTGCATGATATGTTAGAAGGAAGAACACGTTCAAGTTCCTGATGTTCTGTTCTCCTGAAGTCAGCAGTGGTGTTTGACGCCATCAAATATGCAGATCTTTGTGAAAACCTTGACGGGTAAAACCATCACCCTTGAGGTGGAACCCAGTGATACTATCGAGAATGTGAAGGCCAAGATTCAAGACAAAGAAGGTATTCCTCCTGACCAACAGCGACTCATCTTCGCTGGTAAACAGTTGGAGGATGGCCGCACGTTGTCAGACTACAACATTCAGAAAGAGTCCACTCTTCATCTCGTCCTGCGTCTGAGAGGAGGTATCATCGAGCCTTCCCTGAGACAGCTGGCGCAGAAATACAACTGTGACAAAATGATCTGCCGCAAATGCTACGCACGTCTTCACCCCCGTGCAGTCAACTGCCGCAAAAAAAAGTGTGGGCACACCAGCAACCTGCGCCCCAAGAAGAAGCTGAAGTAAACTAGCATTCTCTTTTGTCAATGTTTTCAATAATAATAAAATTGAATTGGAAAAGGG

Function

NR:

description
ubiquitin A-52 residue ribosomal protein fusion product 1like 2

GO:

id name namespace
GO:0006412 translation biological_process
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
K02927 RP-L40e, RPL40, UBA52; ubiquitin-large subunit ribosomal protein L40e

RNA

RNA id representative length rna type GC content exon number start site end site
XM_021612981.2 True 607 mRNA 0.46 5 54443130 54445222
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110530134 LOC106568945 coding downstream 65556 54374233 ~ 54377574 (-)
LOC110530126 LOC106569003 coding downstream 311391 54127068 ~ 54131739 (-)
LOC110530125 LOC106568953 coding downstream 337720 54058122 ~ 54105410 (-)
crsp7 LOC106568954 coding downstream 403558 54024736 ~ 54039572 (-)
cnn2 cnn2 coding downstream 428696 54008434 ~ 54014434 (-)
LOC110530140 LOC106568942 coding upstream 997 54446219 ~ 54465716 (-)
LOC110530141 LOC106568941 coding upstream 32703 54477925 ~ 54485773 (-)
LOC110530142 LOC106568939 coding upstream 53141 54498363 ~ 54507488 (-)
LOC110530144 LOC106568935 coding upstream 253611 54698833 ~ 54975146 (-)
LOC110530149 LOC106568933 coding upstream 629258 55074480 ~ 55084517 (-)
G722949 NA non-coding downstream 37217 54404615 ~ 54405913 (-)
G722906 NA non-coding downstream 111355 54330765 ~ 54331775 (-)
G722862 NA non-coding downstream 166091 54276769 ~ 54277039 (-)
G722863 NA non-coding downstream 170075 54272776 ~ 54273055 (-)
G722860 NA non-coding downstream 179271 54263739 ~ 54263859 (-)
G722978 NA non-coding upstream 23683 54468905 ~ 54469431 (-)
G722990 NA non-coding upstream 64941 54510163 ~ 54510508 (-)
G722993 NA non-coding upstream 68123 54513345 ~ 54514044 (-)
G722997 NA non-coding upstream 72596 54517818 ~ 54518410 (-)
G723017 NA non-coding upstream 112238 54557460 ~ 54557689 (-)
G722864 LOC106581475 other downstream 161152 54281685 ~ 54281978 (-)
G722854 NA other downstream 191584 54251114 ~ 54251546 (-)
G722761 NA other downstream 303789 54124379 ~ 54139341 (-)
G722670 NA other downstream 515171 53926228 ~ 53927959 (-)
G722602 NA other downstream 587065 53803443 ~ 53856065 (-)
G723955 NA other upstream 932059 55377281 ~ 55377776 (-)
G723966 NA other upstream 951402 55396624 ~ 55396885 (-)
G724287 LOC106568908 other upstream 1190316 55635538 ~ 55646014 (-)
G724400 NA other upstream 1340295 55785517 ~ 55791485 (-)
G724943 LOC106604981 other upstream 1674981 56120203 ~ 56128288 (-)

Expression

LOC110530139(LOC100194659) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 150.
End of interactive chart.

LOC110530139(LOC100194659) Expression in each Bioproject

Bar chart with 21 bars.
LOC110530139(LOC100194659) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6000.
End of interactive chart.

Co-expression Network