Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_025856

Basic Information

Item	Value
gene id	XLOC_025856
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007114.7
NCBI id	CM002887.2
chromosome length	62628489
location	59212160 ~ 59224196 (+)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00052392
GATACTGTCAGAGCATTTTACCTCCTCTAGTCTTTCATCCAGACTGAAATCGCTTCTATAAAGGACGTCAGTGGGGATTTTTCGGTCTGATGAGACACGTTTTAGAGCTTCAGCTACTTCAGCTCTCATAACCGAAGAAAGGACGCAAACAACACTAAACAGGAAGGGGACCAATTAGGATGACAGTCGAGCTCTTAATTTCCGAG

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00052392	True	206	lncRNA	0.44	2	59212160	59224196

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_025855	MGAT5B	coding	upstream	44336	59117136 ~ 59167824 (+)
XLOC_025854	rasd4	coding	upstream	159166	59051503 ~ 59052994 (+)
XLOC_025853	NA	coding	upstream	184323	59024934 ~ 59027837 (+)
XLOC_025852	CABZ01044156.1	coding	upstream	222344	58984463 ~ 58989816 (+)
XLOC_025851	CABZ01044154.1	coding	upstream	245063	58961904 ~ 58967097 (+)
XLOC_025857	sec14l1	coding	downstream	187760	59411956 ~ 60282382 (+)
XLOC_025858	pecam1	coding	downstream	560436	59784632 ~ 59822428 (+)
XLOC_025859	CU693479.1	coding	downstream	627341	59851537 ~ 59862797 (+)
XLOC_025860	mcrip1	coding	downstream	640676	59864872 ~ 59876861 (+)
XLOC_025861	alyref	coding	downstream	656121	59880317 ~ 59891841 (+)
XLOC_025429	BX649540.1	misc	upstream	28963124	30248739 ~ 30249036 (+)
XLOC_025850	NA	non-coding	upstream	354677	58835461 ~ 58857483 (+)
XLOC_025848	NA	non-coding	upstream	400327	58806215 ~ 58811833 (+)
XLOC_025847	NA	non-coding	upstream	496954	58712700 ~ 58715206 (+)
XLOC_025865	NA	non-coding	downstream	813354	60037550 ~ 60043897 (+)
XLOC_025868	NA	non-coding	downstream	842192	60066388 ~ 60067768 (+)
XLOC_025870	NA	non-coding	downstream	1132018	60356214 ~ 60357972 (+)
XLOC_025871	NA	non-coding	downstream	1158926	60383122 ~ 60401867 (+)
XLOC_025872	NA	non-coding	downstream	1164053	60388249 ~ 60388895 (+)

Expression

Co-expression Network