LOC110529133


Basic Information

Item Value
gene id LOC110529133
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 66829931 ~ 66830478 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>XR_002474332.2
TAGCCAAAAGGAGAAGAAAGGTATAGTTGGAGATAATGCTGAGAAAGAAGCCTCCACAGCTCTTCCTGACTACCTCCATCGATTCAACTCTGACTGGTACCAAAAGGTCCAAACTACCATGACAAATGAATACACCATCCTTAGGTTTACAGTGCATTGTGGTCTCAATATGGTCCTTGCTCAAATCCACTCCTCAGAATTTCCACCACTGGAGGTGACCAACCAACACAGAAAGTCTGCATGTCCCA

Function

NR:

description
regulator of G-protein signaling protein-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_002474332.2 True 248 mRNA 0.45 3 66829931 66830478

Neighbor

gene id symbol gene type direction distance location
LOC110530397 LOC106569284 coding upstream 108477 66712087 ~ 66721454 (+)
kncn kncn coding upstream 125731 66699211 ~ 66704200 (+)
LOC110530967 NA coding upstream 157324 66671103 ~ 66672607 (+)
LOC118965632 NA coding upstream 180379 66648634 ~ 66649552 (+)
LOC110530393 LOC106569204 coding upstream 233691 66510425 ~ 66596240 (+)
LOC110530398 LOC106569198 coding downstream 37037 66867515 ~ 66935353 (+)
LOC110530399 LOC106569196 coding downstream 118144 66948622 ~ 66973138 (+)
arhgap21b LOC106569193 coding downstream 145203 66975681 ~ 67054754 (+)
LOC110530401 LOC106599252 coding downstream 460199 67290677 ~ 67430071 (+)
LOC110530403 LOC106569190 coding downstream 600375 67430853 ~ 67474302 (+)
G737300 NA non-coding upstream 1305 66828348 ~ 66828626 (+)
G737235 NA non-coding upstream 35554 66787941 ~ 66794377 (+)
G737222 NA non-coding upstream 103043 66725634 ~ 66726888 (+)
G737224 NA non-coding upstream 116616 66713091 ~ 66713315 (+)
G737216 NA non-coding upstream 123457 66704260 ~ 66706474 (+)
G737663 NA non-coding downstream 111124 66941602 ~ 66941897 (+)
G737720 NA non-coding downstream 239569 67070047 ~ 67070309 (+)
G738026 NA non-coding downstream 403416 67233894 ~ 67234129 (+)
G738037 NA non-coding downstream 408751 67239229 ~ 67239429 (+)
G738045 NA non-coding downstream 411970 67242448 ~ 67242852 (+)
G737234 gs02 other upstream 27851 66798573 ~ 66802080 (+)
G737194 LOC106569203 other upstream 174178 66654662 ~ 66655753 (+)
si:ch211-106n13.3 LOC106569214 other upstream 704593 66100360 ~ 66125932 (+)
LOC110530364 LOC106569228 other upstream 1161836 65659289 ~ 65670369 (+)
G737783 NA other downstream 339989 67170467 ~ 67215629 (+)
G738020 NA other downstream 400704 67231182 ~ 67231913 (+)
G738244 NA other downstream 715651 67546129 ~ 67547609 (+)
LOC110530413 NA other downstream 1075899 67904516 ~ 67924427 (+)
G739648 NA other downstream 2027905 68858383 ~ 68858753 (+)

Expression


Co-expression Network