LOC118965661



Basic Information


Item Value
gene id LOC118965661
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 89952616 ~ 89952684 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005053039.1
TTTCAATGACGATATTCATGTCCAGTTCTGCTACTGAATGTTTGTGACGATATTTGTGACTCTGAGAAA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005053039.1 True 69 mRNA 0.36 1 89952616 89952684
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965662 NA coding upstream 278 89952232 ~ 89952338 (+)
hectd3 hectd3 coding upstream 4973 89932208 ~ 89947643 (+)
best4 LOC106569841 coding upstream 20542 89917042 ~ 89932074 (+)
ndc1 ndc1 coding upstream 41022 89861821 ~ 89911594 (+)
zgc:113691 LOC106569840 coding upstream 98241 89853466 ~ 89854375 (+)
acadm acadm coding downstream 14825 89967509 ~ 89974264 (+)
rabggtb rabggtb coding downstream 22848 89975532 ~ 89991005 (+)
st6galnac3 LOC106591001 coding downstream 78340 90031024 ~ 90108312 (+)
LOC110515626 LOC108444490 coding downstream 275977 90228661 ~ 90295350 (+)
LOC110530899 LOC106569745 coding downstream 421387 90374071 ~ 90397563 (+)
G760503 NA non-coding upstream 2979 89949135 ~ 89949637 (+)
G760498 NA non-coding upstream 28216 89923060 ~ 89924400 (+)
G760491 NA non-coding upstream 37447 89914970 ~ 89915169 (+)
G759979 NA non-coding upstream 40312 89911869 ~ 89912304 (+)
G759970 NA non-coding upstream 94876 89857459 ~ 89857740 (+)
G760511 NA non-coding downstream 26906 89979590 ~ 89980502 (+)
G760513 NA non-coding downstream 41790 89994474 ~ 89994710 (+)
G760515 NA non-coding downstream 45263 89997947 ~ 89998361 (+)
G760516 NA non-coding downstream 45796 89998480 ~ 89998878 (+)
G760517 NA non-coding downstream 46250 89998934 ~ 89999607 (+)
G759892 NA other upstream 255709 89696420 ~ 89696907 (+)
LOC118965583 LOC106569839 other upstream 293269 89560138 ~ 89659347 (+)
slc25a24l LOC106569755 other upstream 858222 89074624 ~ 89139486 (+)
G759598 NA other upstream 1090788 88861079 ~ 88861828 (+)
G759556 NA other upstream 1251197 88697974 ~ 88701419 (+)
G760623 NA other downstream 207586 90160270 ~ 90208959 (+)
G760718 NA other downstream 421403 90362653 ~ 90400472 (+)
LOC110530875 rpl37a other downstream 747611 90700188 ~ 90709778 (+)
ndufb3 ndufb3 other downstream 784607 90737231 ~ 90743084 (+)
G760857 NA other downstream 817433 90770117 ~ 90771037 (+)

Expression


LOC118965661 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

LOC118965661 Expression in each Bioproject

Bar chart with 2 bars.
LOC118965661 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3.
End of interactive chart.

Co-expression Network