G663244



Basic Information


Item Value
gene id G663244
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 450712 ~ 451295 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU754897
gaagtaatatggtggtaatatggaagtaatatggtggtaatatggtggtaatatggtggtaatatggtggtaatatggaagtaatatggtggtaatatggtggtaatatggaagtaatatggtggtaatatggtggtaatatggtggtaatatggtggtaatatggtggtaatatggtggtaatatggtggtaatatggaagtaatatggtggtaatatggcggtaatatggtagtaatatggtagtaatatggtggtaatatggtggtaatatggtggtaatatggtagtaatatggtggtaatatggtagtaatatggtggtaatatggtggtaatatggtggtaatatggtggtaatatgg

Function


NR:

description
uncharacterized protein LOC111609315

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU754897 True 364 lncRNA 0.34 2 450712 451295

Neighbor


gene id symbol gene type direction distance location
LOC118965589 NA coding downstream 178700 270675 ~ 272012 (-)
hmgn3 LOC106570980 coding downstream 199620 204110 ~ 251092 (-)
LOC110515871 phip coding downstream 254707 67258 ~ 196005 (-)
LOC118965475 LOC106570990 coding upstream 248728 700023 ~ 712275 (-)
LOC110513701 LOC106570988 coding upstream 268739 716794 ~ 833087 (-)
LOC118965602 NA coding upstream 709527 1160822 ~ 1162168 (-)
LOC118965476 ppp1r14c coding upstream 878378 1307226 ~ 1414828 (-)
LOC118965590 NA coding upstream 972192 1423487 ~ 1424991 (-)
G663239 NA non-coding downstream 17941 432475 ~ 432771 (-)
G663225 NA non-coding downstream 35627 414869 ~ 415085 (-)
G663223 NA non-coding downstream 37011 413416 ~ 413701 (-)
G663215 NA non-coding downstream 62519 381322 ~ 388193 (-)
G663206 NA non-coding downstream 80894 360065 ~ 369818 (-)
G663248 NA non-coding upstream 6355 457650 ~ 458015 (-)
G663254 NA non-coding upstream 8103 459398 ~ 466163 (-)
G663255 NA non-coding upstream 10168 461463 ~ 464933 (-)
G663257 NA non-coding upstream 15155 466450 ~ 467266 (-)
G663438 NA non-coding upstream 95589 546884 ~ 547390 (-)
G663235 NA other downstream 20454 428191 ~ 430258 (-)
G664089 NA other upstream 986465 1437760 ~ 1438441 (-)
armc1l LOC106571055 other upstream 1028880 1479450 ~ 1498700 (-)
G664733 NA other upstream 1542594 1993889 ~ 1994530 (-)
G664763 rab10 other upstream 1840107 2291402 ~ 2350981 (-)
G665603 NA other upstream 2785593 3236888 ~ 3240052 (-)

Expression


G663244 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G663244 Expression in each Bioproject

Bar chart with 5 bars.
G663244 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network