G663248



Basic Information


Item Value
gene id G663248
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 457650 ~ 458015 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU754901
ctacctctccagcgctgtcggagtctcccgcctgtttagcgctgttagagccttccttctctacagcgctgccggagtctcccgcctgttcagaactgccagtttgcaaagagctgccagttagcatagagctgccagttagcatagagctgccagttagcatagagctgccagttagcatagagctgccagttagcatagagctgccagttagcatagagctgccagtctgcaaggagctgccagtctgcaaggagctgccagtctgcaaggagctgccagtctgcatagagctgccagtctgcaaggagctgccagtctgcaaggagccgccagagctgccagtctgcaaggagccgccagagc

Function


NR:

description
adiponectin-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU754901 True 366 lncRNA 0.58 1 457650 458015
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118965589 NA coding downstream 185638 270675 ~ 272012 (-)
hmgn3 LOC106570980 coding downstream 206558 204110 ~ 251092 (-)
LOC110515871 phip coding downstream 261645 67258 ~ 196005 (-)
LOC118965475 LOC106570990 coding upstream 242008 700023 ~ 712275 (-)
LOC110513701 LOC106570988 coding upstream 262019 716794 ~ 833087 (-)
LOC118965602 NA coding upstream 702807 1160822 ~ 1162168 (-)
LOC118965476 ppp1r14c coding upstream 871658 1307226 ~ 1414828 (-)
LOC118965590 NA coding upstream 965472 1423487 ~ 1424991 (-)
G663244 NA non-coding downstream 6355 450712 ~ 451295 (-)
G663239 NA non-coding downstream 24879 432475 ~ 432771 (-)
G663225 NA non-coding downstream 42565 414869 ~ 415085 (-)
G663223 NA non-coding downstream 43949 413416 ~ 413701 (-)
G663215 NA non-coding downstream 69457 381322 ~ 388193 (-)
G663254 NA non-coding upstream 1383 459398 ~ 466163 (-)
G663255 NA non-coding upstream 3448 461463 ~ 464933 (-)
G663257 NA non-coding upstream 8435 466450 ~ 467266 (-)
G663438 NA non-coding upstream 88869 546884 ~ 547390 (-)
G663445 NA non-coding upstream 114425 572440 ~ 573140 (-)
G663235 NA other downstream 27392 428191 ~ 430258 (-)
G664089 NA other upstream 979745 1437760 ~ 1438441 (-)
armc1l LOC106571055 other upstream 1022160 1479450 ~ 1498700 (-)
G664733 NA other upstream 1535874 1993889 ~ 1994530 (-)
G664763 rab10 other upstream 1833387 2291402 ~ 2350981 (-)
G665603 NA other upstream 2778873 3236888 ~ 3240052 (-)

Expression


G663248 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G663248 Expression in each Bioproject

Bar chart with 20 bars.
G663248 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network