G663445


Basic Information

Item Value
gene id G663445
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 572440 ~ 573140 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU755141
gttatattcagcatttcacggtaaggtctacctgttgtattcagcatttcactgtgaggtctacctgttgtattcagcatttcacggtaaggtctacctgttgtattcagcatttcacggtaaggtctacctgttgtattcagcatttcacggtaaggtctacctgttgtattcggcatttcacggtaaggtctacctgttgtattc
>TU755142
ctgttgtattcatcattcctctgtgaggtctactacacctgttatattcagcatttcacggtaaggtctacctgttgtattcagcatttcactgtgaggtctactacacctgttgtattcatcatttctctgtgaggtctactacatctgttatATTcagaatttcacggtaaggtctacctgttgtattcagcatttcacggtaaggtctacctgttgtattcagcatttcacggtaaggtctacctgttgtattcagcatttcacggtaaggtctactacacctgttgtattcatcatttctctgtgaggtctactacatctgttatATTcagaatttcacggtaaggtctacctgttgtattcagcatttcacggtaaggtctacctgttgtattcagcatttcacggtaaggtctacctgttgtattcagcatttcacggtaaggtctacctgttgtattcggcatttcacggtaaggtctacctgttgtattc

Function

NR:

description
PREDICTED: uncharacterized protein PB18E9.04c-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU755141 False 207 lncRNA 0.42 2 572440 572722
TU755142 True 498 lncRNA 0.41 2 572440 573140

Neighbor

gene id symbol gene type direction distance location
LOC118965589 NA coding downstream 300428 270675 ~ 272012 (-)
hmgn3 LOC106570980 coding downstream 321348 204110 ~ 251092 (-)
LOC110515871 phip coding downstream 376435 67258 ~ 196005 (-)
LOC118965475 LOC106570990 coding upstream 126883 700023 ~ 712275 (-)
LOC110513701 LOC106570988 coding upstream 146894 716794 ~ 833087 (-)
LOC118965602 NA coding upstream 587682 1160822 ~ 1162168 (-)
LOC118965476 ppp1r14c coding upstream 756533 1307226 ~ 1414828 (-)
LOC118965590 NA coding upstream 850347 1423487 ~ 1424991 (-)
G663438 NA non-coding downstream 25050 546884 ~ 547390 (-)
G663257 NA non-coding downstream 105174 466450 ~ 467266 (-)
G663254 NA non-coding downstream 106277 459398 ~ 466163 (-)
G663255 NA non-coding downstream 107507 461463 ~ 464933 (-)
G663248 NA non-coding downstream 114425 457650 ~ 458015 (-)
G663466 NA non-coding upstream 45257 618397 ~ 618689 (-)
G663485 NA non-coding upstream 87782 660922 ~ 661730 (-)
G663491 NA non-coding upstream 99184 672324 ~ 676101 (-)
G663497 NA non-coding upstream 115728 688868 ~ 689135 (-)
G663488 NA non-coding upstream 123852 696992 ~ 697606 (-)
G663235 NA other downstream 142182 428191 ~ 430258 (-)
G663215 NA other downstream 185458 381322 ~ 388193 (-)
G664089 NA other upstream 864620 1437760 ~ 1438441 (-)
armc1l LOC106571055 other upstream 907035 1479450 ~ 1498700 (-)
G664733 NA other upstream 1420749 1993889 ~ 1994530 (-)
G664763 rab10 other upstream 1718262 2291402 ~ 2350981 (-)
G665603 NA other upstream 2663748 3236888 ~ 3240052 (-)

Expression

G663445 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G663445 Expression in each Bioproject

Bar chart with 10 bars.
G663445 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network