G663951



Basic Information


Item Value
gene id G663951
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 1295702 ~ 1295920 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU755734
ATGTAACAATCCACAAAAATTATCAAGTATTGAATGGTTAATCTAGGCTGTTTAAAAGGTTTTCGACACAAATAAAATCATTAAATCATCGCGCTCAACCAAACATTTCCCCAAACTGCTACTACATTCCTCTCCAAGGGAAATGCCCTCTTTAAGGTATAATCCACCGAATTGACAATGGCAGCCATTTAGATTTTTTCCAAATAACGAAGTCAGAGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU755734 True 219 lncRNA 0.36 1 1295702 1295920
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110516199 fam84a coding upstream 428311 863590 ~ 867391 (+)
LOC110530744 LOC100286411 coding upstream 622817 576383 ~ 672885 (+)
LOC118965477 NA coding downstream 725948 2021868 ~ 2027055 (+)
LOC118965478 NA coding downstream 764277 2058495 ~ 2061976 (+)
LOC110523088 rab10 coding downstream 995462 2291382 ~ 2350985 (+)
LOC118965479 NA coding downstream 996448 2292368 ~ 2295883 (+)
LOC118965480 NA coding downstream 1147186 2443106 ~ 2444575 (+)
G663945 NA non-coding upstream 3552 1291909 ~ 1292150 (+)
G663944 NA non-coding upstream 4021 1291439 ~ 1291681 (+)
G663928 NA non-coding upstream 24464 1270922 ~ 1271238 (+)
G663924 NA non-coding upstream 26363 1269108 ~ 1269339 (+)
G663918 NA non-coding upstream 32003 1263418 ~ 1263699 (+)
G663954 NA non-coding downstream 3053 1298973 ~ 1299186 (+)
G663958 NA non-coding downstream 8839 1304759 ~ 1305175 (+)
G663962 NA non-coding downstream 27483 1323403 ~ 1331182 (+)
G663967 NA non-coding downstream 53572 1349492 ~ 1363800 (+)
G663976 NA non-coding downstream 84894 1380814 ~ 1381360 (+)
G663377 NA other upstream 536335 757827 ~ 759367 (+)
G663359 NA other upstream 574667 717893 ~ 721035 (+)
G663012 NA other upstream 1090632 204123 ~ 205230 (+)
G662941 NA other upstream 1211163 62282 ~ 84539 (+)
G664034 NA other downstream 139150 1435070 ~ 1436094 (+)
G664560 NA other downstream 935425 2231345 ~ 2235813 (+)
G664930 NA other downstream 1167755 2463675 ~ 2479558 (+)

Expression


G663951 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G663951 Expression in each Bioproject

Bar chart with 5 bars.
G663951 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network