G666731



Basic Information


Item Value
gene id G666731
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 5512248 ~ 5512449 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU759219
gggatgcttgtggaaggctacccgaaacgttttacccaagttaaacaatttaaaggcaatgttactaaatactaattgagtgtatgcaaacttctgacccactgggaatgtgatgaaagaaataaaagctgaaataaatcattcactctactattattctgacatttcacattcttaaaataaagtggtgatcctaactgac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU759219 True 202 lncRNA 0.35 1 5512248 5512449
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529283 NA coding upstream 17415 5493169 ~ 5494833 (+)
LOC118965485 NA coding upstream 48147 5450478 ~ 5480729 (+)
LOC110529165 LOC106571042 coding upstream 206935 5295169 ~ 5305313 (+)
LOC110529281 dlst coding upstream 287604 5204691 ~ 5224644 (+)
LOC110529279 LOC106571050 coding upstream 327455 5128963 ~ 5184793 (+)
LOC110529285 NA coding downstream 2011 5514460 ~ 5532745 (+)
LOC118965486 NA coding downstream 59050 5571499 ~ 5578771 (+)
mcm3 mcm3 coding downstream 84150 5596599 ~ 5629511 (+)
il17a/f3 LOC106571057 coding downstream 132608 5645057 ~ 5647003 (+)
emilin1a LOC106571081 coding downstream 226496 5738945 ~ 5788810 (+)
G666724 NA non-coding upstream 21937 5488842 ~ 5490311 (+)
G666689 LOC100194703 non-coding upstream 88069 5417233 ~ 5424179 (+)
G666685 NA non-coding upstream 99369 5409024 ~ 5412879 (+)
G666687 NA non-coding upstream 99453 5411069 ~ 5412795 (+)
G666739 NA non-coding downstream 8424 5520873 ~ 5521089 (+)
G666742 NA non-coding downstream 17883 5530332 ~ 5530621 (+)
G666733 NA non-coding downstream 22438 5534887 ~ 5535533 (+)
G666754 NA non-coding downstream 40927 5553376 ~ 5553612 (+)
G666756 NA non-coding downstream 42513 5554962 ~ 5555213 (+)
G666447 NA other upstream 665729 4845405 ~ 4846519 (+)
G666161 NA other upstream 834913 4526104 ~ 4770119 (+)
G666768 NA other downstream 58439 5570888 ~ 5571487 (+)
LOC110529172 LOC106571080 other downstream 287857 5799702 ~ 5802487 (+)
G668043 NA other downstream 580896 6093345 ~ 6185271 (+)
G668334 NA other downstream 899551 6412000 ~ 6413087 (+)
G668368 NA other downstream 933431 6445880 ~ 6446445 (+)

Expression


G666731 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G666731 Expression in each Bioproject

Bar chart with 18 bars.
G666731 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network