G669814



Basic Information


Item Value
gene id G669814
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 8225844 ~ 8226088 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU763016
gtaaacaacaggtgtagtagactaacagtgaaatgcttcttaatcaacaggtgtagactaacagtgaaatgcttcttaatcaacaggtgtagactaacagtgaaatgcttcttaatcaacaggtgtagactaacagtgaaatgcttcttaatcaacaggtgtagactaacagggaaatgcttacttacaggcccttcccaacaatgtag

Function


NR:

description
PREDICTED: uncharacterized protein LOC108268585

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU763016 True 209 lncRNA 0.38 2 8225844 8226088

Neighbor


gene id symbol gene type direction distance location
LOC110529309 LOC106571095 coding upstream 290849 7929359 ~ 7934995 (+)
LOC110529308 LOC106571096 coding upstream 302220 7913950 ~ 7923624 (+)
gpr176 LOC106571060 coding upstream 688915 7515258 ~ 7536929 (+)
LOC110529173 LOC106571059 coding upstream 728705 7476858 ~ 7497139 (+)
LOC118965596 NA coding upstream 842272 7382121 ~ 7383572 (+)
LOC110529313 LOC106571113 coding downstream 57792 8283880 ~ 8341125 (+)
LOC110529318 LOC106571115 coding downstream 159362 8385450 ~ 8393449 (+)
LOC100136137 LOC106571105 coding downstream 176136 8402224 ~ 8423584 (+)
LOC110529321 LOC106571114 coding downstream 516451 8742539 ~ 8757466 (+)
LOC110529326 LOC106571110 coding downstream 678501 8904589 ~ 8914229 (+)
G669788 NA non-coding upstream 47038 8178356 ~ 8178806 (+)
G669657 NA non-coding upstream 136288 8012738 ~ 8089556 (+)
G669724 NA non-coding upstream 155905 8069178 ~ 8069939 (+)
G669723 NA non-coding upstream 156904 8068119 ~ 8068940 (+)
G669706 NA non-coding upstream 178591 8044196 ~ 8047253 (+)
G669988 NA non-coding downstream 32098 8258186 ~ 8258595 (+)
G670000 NA non-coding downstream 45952 8272040 ~ 8272930 (+)
G670004 NA non-coding downstream 54675 8280763 ~ 8280966 (+)
G670025 NA non-coding downstream 102314 8328402 ~ 8335422 (+)
G669992 NA non-coding downstream 116257 8342345 ~ 8344560 (+)
G668626 NA other upstream 1226538 6998228 ~ 6999306 (+)
G668628 NA other upstream 1234236 6989854 ~ 7076589 (+)
G668649 NA other upstream 1254240 6971079 ~ 6971604 (+)
G668368 NA other upstream 1779399 6445880 ~ 6446445 (+)
G668334 NA other upstream 1812757 6412000 ~ 6413087 (+)
G670034 NA other downstream 144036 8370124 ~ 8376409 (+)
G670169 NA other downstream 240627 8466715 ~ 8467460 (+)
G670939 LOC106571120 other downstream 1068407 9294495 ~ 9352851 (+)
LOC110529331 LOC106571120 other downstream 1126835 9336069 ~ 9366106 (+)
G670992 NA other downstream 1299635 9498702 ~ 9613040 (+)

Expression


G669814 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G669814 Expression in each Bioproject

Bar chart with 2 bars.
G669814 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network