G674341



Basic Information


Item Value
gene id G674341
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 12586741 ~ 12586951 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU768140
taccaacatgtatcaagcagaccaccatagtccctgtgcccaagaacactatggtaaactgcctaaatgactgccgacctgtagcactcacttctgtagccatgaaatgctttgaaaggctggtcatggctcacatcaacaccatcatcccagaaaccctagacccactccaatttgcataccgcaccaacagatgcaatcactattgcac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU768140 True 211 lncRNA 0.47 1 12586741 12586951
Loading

Neighbor


gene id symbol gene type direction distance location
rd3 LOC106571197 coding downstream 34615 12541870 ~ 12552126 (-)
si:dkey-12h9.6 LOC106571193 coding downstream 129727 12439978 ~ 12457014 (-)
capn3b can3 coding downstream 174481 12371350 ~ 12412260 (-)
churc1 churc1 coding downstream 238053 12345907 ~ 12348688 (-)
mideasa LOC106571189 coding downstream 256706 12315015 ~ 12330035 (-)
slc30a1a znt1 coding upstream 5731 12592682 ~ 12602018 (-)
nek2 LOC106571199 coding upstream 17745 12604696 ~ 12610815 (-)
lpgat1 lpgat1 coding upstream 28928 12615879 ~ 12697323 (-)
ints7 ints7 coding upstream 110555 12697506 ~ 12707399 (-)
sytl3 sytl3 coding upstream 342312 12929263 ~ 12943135 (-)
G674336 NA non-coding downstream 9074 12577442 ~ 12577667 (-)
G674334 NA non-coding downstream 10580 12575876 ~ 12576161 (-)
G674332 NA non-coding downstream 12840 12573098 ~ 12573901 (-)
G674326 NA non-coding downstream 19187 12567047 ~ 12567554 (-)
G674208 NA non-coding downstream 153598 12432447 ~ 12433143 (-)
G674722 NA non-coding upstream 37474 12624425 ~ 12625843 (-)
G674732 NA non-coding upstream 55475 12642426 ~ 12642796 (-)
G674770 NA non-coding upstream 117116 12704067 ~ 12704268 (-)
G674806 NA non-coding upstream 179422 12766373 ~ 12766850 (-)
G674015 NA other downstream 302521 12283837 ~ 12284220 (-)
G673867 NA other downstream 444747 12140370 ~ 12141994 (-)
G673863 NA other downstream 560999 12018616 ~ 12025742 (-)
LOC110529377 LOC106571175 other downstream 589250 11984834 ~ 11997491 (-)
G673053 NA other downstream 1241959 11344473 ~ 11344782 (-)
LOC110529426 NA other upstream 787988 13373030 ~ 13451428 (-)
G675413 NA other upstream 897142 13484093 ~ 13484934 (-)
G675415 NA other upstream 898728 13485679 ~ 13486137 (-)
G675834 LOC106571238 other upstream 1396675 13983626 ~ 13986108 (-)

Expression


G674341 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G674341 Expression in each Bioproject

Bar chart with 19 bars.
G674341 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network