G675705



Basic Information


Item Value
gene id G675705
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 13855660 ~ 13856282 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU769658
aagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaagatgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttaagtttggcgtaaaagcaacacagctcatcaccctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgacgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacataccccaagc

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU769658 True 623 TUCP 0.43 1 13855660 13856282

Neighbor


gene id symbol gene type direction distance location
LOC110529187 LOC106571237 coding upstream 165350 13646726 ~ 13690310 (+)
LOC100136058 LOC100136058 coding upstream 258534 13594644 ~ 13597126 (+)
slc35b2 slc35b2 coding upstream 311138 13534945 ~ 13548396 (+)
nfkbie nfkbie coding upstream 329067 13516606 ~ 13526593 (+)
tcte1 tcte1 coding upstream 359048 13487003 ~ 13496612 (+)
LOC110529436 LOC106571238 coding downstream 127532 13983814 ~ 13986113 (+)
LOC110529438 LOC106571257 coding downstream 371597 14227879 ~ 14270782 (+)
LOC118965598 NA coding downstream 415379 14271661 ~ 14281048 (+)
LOC110529440 id2 coding downstream 481393 14337675 ~ 14339965 (+)
LOC110529189 e2f6 coding downstream 614972 14471254 ~ 14474225 (+)
G675667 NA non-coding upstream 33381 13821957 ~ 13822279 (+)
G675665 NA non-coding upstream 34053 13821378 ~ 13821607 (+)
G675631 LOC106600263 non-coding upstream 64537 13790890 ~ 13791123 (+)
G675629 NA non-coding upstream 67313 13788078 ~ 13788347 (+)
G675615 NA non-coding upstream 74724 13780307 ~ 13780936 (+)
G675808 NA non-coding downstream 107507 13963789 ~ 13964167 (+)
G675824 NA non-coding downstream 119049 13975331 ~ 13975648 (+)
G675839 NA non-coding downstream 134327 13990609 ~ 13990984 (+)
G675855 NA non-coding downstream 143508 13999790 ~ 14000058 (+)
G675857 NA non-coding downstream 143993 14000275 ~ 14000565 (+)
G675607 NA other upstream 80388 13774672 ~ 13775272 (+)
G675212 hsp90ab1 other upstream 301597 13552200 ~ 13554063 (+)
G674669 LOC105902936 other upstream 669163 13186107 ~ 13186497 (+)
G674668 NA other upstream 670068 13185213 ~ 13185592 (+)
znf106b LOC106571191 other upstream 1503521 12348710 ~ 12373335 (+)
G676226 NA other downstream 504295 14360577 ~ 14362971 (+)
LOC110529454 LOC106571249 other downstream 899716 14749575 ~ 14758924 (+)
G676919 NA other downstream 1249321 15105603 ~ 15107143 (+)
LOC110529464 LOC106571299 other downstream 1402197 15258311 ~ 15260331 (+)
G678417 LOC106571283 other downstream 2528520 16384802 ~ 16385945 (+)

Expression


G675705 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G675705 Expression in each Bioproject

Bar chart with 20 bars.
G675705 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network