G676013



Basic Information


Item Value
gene id G676013
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 14142882 ~ 14143100 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU769979
tgtacactatatcatctactgcatctttatgtaatacatgtatcactagccactttaaactatgccactttgtttacataccctacattactcatctcatatgtatatactgtactcgacaccatctactgcatcttgcctatgccgttctgtaccatcactcattcatatatctttatgtacatattctttatccctttacacttgtgtgtatacggt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU769979 True 219 lncRNA 0.35 1 14142882 14143100

Neighbor


gene id symbol gene type direction distance location
LOC110529436 LOC106571238 coding upstream 156769 13983814 ~ 13986113 (+)
LOC110529187 LOC106571237 coding upstream 452572 13646726 ~ 13690310 (+)
LOC100136058 LOC100136058 coding upstream 545756 13594644 ~ 13597126 (+)
slc35b2 slc35b2 coding upstream 598360 13534945 ~ 13548396 (+)
nfkbie nfkbie coding upstream 616289 13516606 ~ 13526593 (+)
LOC110529438 LOC106571257 coding downstream 84779 14227879 ~ 14270782 (+)
LOC118965598 NA coding downstream 128561 14271661 ~ 14281048 (+)
LOC110529440 id2 coding downstream 194575 14337675 ~ 14339965 (+)
LOC110529189 e2f6 coding downstream 328154 14471254 ~ 14474225 (+)
LOC118936419 NA coding downstream 334537 14477637 ~ 14479489 (+)
G676007 NA non-coding upstream 3871 14138633 ~ 14139011 (+)
G676000 NA non-coding upstream 14684 14127982 ~ 14128198 (+)
G675930 NA non-coding upstream 73580 14068646 ~ 14069302 (+)
G675914 NA non-coding upstream 89263 14053330 ~ 14053619 (+)
G675889 NA non-coding upstream 119873 14022795 ~ 14023009 (+)
G676023 NA non-coding downstream 9904 14153004 ~ 14153204 (+)
G676029 NA non-coding downstream 15583 14158683 ~ 14158894 (+)
G676056 NA non-coding downstream 45184 14188284 ~ 14188582 (+)
G676059 NA non-coding downstream 46289 14189389 ~ 14189598 (+)
G676074 NA non-coding downstream 62755 14205855 ~ 14206149 (+)
G675705 NA other upstream 286600 13855660 ~ 13856282 (+)
G675607 NA other upstream 367610 13774672 ~ 13775272 (+)
G675212 hsp90ab1 other upstream 588819 13552200 ~ 13554063 (+)
G674669 LOC105902936 other upstream 956385 13186107 ~ 13186497 (+)
G674668 NA other upstream 957290 13185213 ~ 13185592 (+)
G676226 NA other downstream 217477 14360577 ~ 14362971 (+)
LOC110529454 LOC106571249 other downstream 612898 14749575 ~ 14758924 (+)
G676919 NA other downstream 962503 15105603 ~ 15107143 (+)
LOC110529464 LOC106571299 other downstream 1115379 15258311 ~ 15260331 (+)
G678417 LOC106571283 other downstream 2241702 16384802 ~ 16385945 (+)

Expression


G676013 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G676013 Expression in each Bioproject

Bar chart with 14 bars.
G676013 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network