G676691



Basic Information


Item Value
gene id G676691
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 14602515 ~ 14602782 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU770737
cactgaaacatgcgtgagagcaccagctgttccagaagactgtgtgatcacgctctccgcagccaatgtcagtaagagctttaaacaggtcaacattcacaaggccgcagggccagacggattaccaggacgtgtactgcgagcatgcgctgatcaactggcaagtgtcttcactgacattttcaacctctcactgtctgagtctgtaataccaacatgttttaagcagaccaccatagtgcctgtgcccaagaacactaaggtaacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU770737 True 268 lncRNA 0.50 1 14602515 14602782

Neighbor


gene id symbol gene type direction distance location
LOC110529446 LOC106571252 coding downstream 28931 14549681 ~ 14573584 (-)
LOC110529444 LOC106571255 coding downstream 131386 14396011 ~ 14471129 (-)
LOC110529441 LOC106571256 coding downstream 209857 14340500 ~ 14392658 (-)
LOC110529435 LOC106571224 coding downstream 969659 13626761 ~ 13632856 (-)
LOC110529434 LOC106571223 coding downstream 1000954 13598376 ~ 13601561 (-)
LOC110529453 LOC105017813 coding upstream 120990 14723772 ~ 14748569 (-)
LOC110529452 LOC106571249 coding upstream 153209 14755991 ~ 14850443 (-)
LOC110529455 LOC106571248 coding upstream 286015 14888797 ~ 14901607 (-)
LOC110529190 LOC106571247 coding upstream 306093 14908875 ~ 14965313 (-)
LOC110529456 LOC106571246 coding upstream 368832 14971614 ~ 14980854 (-)
G676649 NA non-coding downstream 69074 14533213 ~ 14533441 (-)
G676648 NA non-coding downstream 69563 14532700 ~ 14532952 (-)
G676646 NA non-coding downstream 70264 14529486 ~ 14532251 (-)
G676645 NA non-coding downstream 73061 14529228 ~ 14529454 (-)
G676635 LOC106571254 non-coding downstream 92087 14508329 ~ 14516528 (-)
G676696 NA non-coding upstream 12903 14615685 ~ 14746960 (-)
G676705 NA non-coding upstream 30411 14633193 ~ 14635877 (-)
G676717 NA non-coding upstream 74172 14676954 ~ 14684085 (-)
G676722 tieg3 non-coding upstream 91084 14693866 ~ 14695835 (-)
G676753 NA non-coding upstream 122894 14725676 ~ 14725935 (-)
G676178 NA other downstream 314170 14287849 ~ 14288345 (-)
G676077 NA other downstream 394890 14206987 ~ 14207625 (-)
G675834 LOC106571238 other downstream 616407 13983626 ~ 13986108 (-)
G675415 NA other downstream 1116378 13485679 ~ 13486137 (-)
G679087 NA other upstream 1829839 16432621 ~ 16433014 (-)
G679210 LOC106571290 other upstream 2022308 16625090 ~ 16630259 (-)
G679471 NA other upstream 2510761 17113543 ~ 17114528 (-)
G681659 NA other upstream 4188448 18791230 ~ 18792137 (-)
G684844 NA other upstream 6875984 21478766 ~ 21479203 (-)

Expression


G676691 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G676691 Expression in each Bioproject

Bar chart with 20 bars.
G676691 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network