XLOC_026046


Basic Information

Item Value
gene id XLOC_026046
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 6073491 ~ 6095821 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00052427
TAGACAAAGTGTGACGAGCTGAAAGCGGTCACTTAATGTCCACATGGGGGCGATGTATTTTAAAAAACGCCTCTCTATCGTGGGAGATGGATAAAGGAAGGAAGTGTTTGTTTGCCAGGAAGTGAACATGCGGAGCTTCGGCTAGGAGCTCAGGCAATGATGGCTCGGGCTGAAATGAATCGTCTGGCTGAGAGACAATGTGTTTGTTTGGTTAACTACTGTAATCTTCGGACTGGTCAGCCCGCCCGCTGTGGCAATTTACAGACCTCGGTGCTCATTCGGCCTTTGGCTCCTCATTCCCACCCTGCTCCAGCCTGTTCAGATCCTCCAACTGCAGCGATACTTCGACACAC

Function

GO:

id name namespace
GO:0001704 formation of primary germ layer biological_process
GO:0001707 mesoderm formation biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0007498 mesoderm development biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0009887 animal organ morphogenesis biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0048570 notochord morphogenesis biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0021915 neural tube development biological_process
GO:0033504 floor plate development biological_process
GO:0048598 embryonic morphogenesis biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0048320 axial mesoderm formation biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0048332 mesoderm morphogenesis biological_process
GO:0007369 gastrulation biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00052427 True 353 lncRNA 0.51 2 6073491 6095821

Neighbor

gene id symbol gene type direction distance location
XLOC_026045 NA coding downstream 22415 6046988 ~ 6051076 (-)
XLOC_026044 mcoln1b coding downstream 37725 5991765 ~ 6035766 (-)
XLOC_026043 BX284638.2 coding downstream 108934 5882130 ~ 5964557 (-)
XLOC_026042 pkn1b coding downstream 243990 5778954 ~ 5829501 (-)
XLOC_026041 CABZ01064408.1 coding downstream 323464 5744408 ~ 5750027 (-)
XLOC_026047 si:ch73-144l3.1 coding upstream 82526 6178347 ~ 6191950 (-)
XLOC_026048 NA coding upstream 107915 6203736 ~ 6211960 (-)
XLOC_026049 NA coding upstream 124260 6220081 ~ 6228146 (-)
XLOC_026050 NA coding upstream 141277 6237098 ~ 6240065 (-)
XLOC_026051 BX004785.2 coding upstream 182931 6278752 ~ 6281503 (-)
XLOC_026040 CABZ01064405.1 non-coding downstream 347873 5718913 ~ 5725618 (-)
XLOC_026039 CABZ01064402.1 non-coding downstream 375759 5697609 ~ 5697732 (-)
XLOC_026035 NA non-coding downstream 543511 5526109 ~ 5529980 (-)
XLOC_026052 NA non-coding upstream 212872 6308693 ~ 6376938 (-)
XLOC_026056 NA non-coding upstream 429877 6525698 ~ 6529154 (-)

Expression


Co-expression Network