G679089



Basic Information


Item Value
gene id G679089
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 16435100 ~ 16435299 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU773513
gtgatatactgggccattcgcactaccctctgtagtgccttgcggtcggaggccgagcagttgcagtaccaggcagtgatgcaaccatgctctcaatgttgcagctgttaaaccttttgaggatctgaggacccatgccaaatcttttcagtctcctgagggggaataggttttgtcgtgcactcttcacgactgtcttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU773513 True 200 lncRNA 0.52 1 16435100 16435299

Neighbor


gene id symbol gene type direction distance location
LOC100499588 LOC100499588 coding downstream 8595 16424860 ~ 16426505 (-)
gjb7 LOC106571283 coding downstream 48455 16383314 ~ 16386645 (-)
LOC118965674 NA coding downstream 146468 16288561 ~ 16288632 (-)
LOC118965673 NA coding downstream 146715 16288314 ~ 16288385 (-)
LOC118965665 NA coding downstream 146962 16288067 ~ 16288138 (-)
LOC110529495 LOC106571286 coding upstream 4259 16439558 ~ 16445013 (-)
LOC118965497 NA coding upstream 32120 16467419 ~ 16505761 (-)
LOC110529498 LOC106571289 coding upstream 204547 16639846 ~ 16674144 (-)
LOC110529499 LOC106571292 coding upstream 250462 16685761 ~ 16720691 (-)
LOC110529501 LOC106571293 coding upstream 285863 16721162 ~ 16758117 (-)
G679081 NA non-coding downstream 23200 16411648 ~ 16411900 (-)
G679080 cfap206 non-coding downstream 23528 16410599 ~ 16411572 (-)
G679078 NA non-coding downstream 26520 16408297 ~ 16408580 (-)
G679076 cfap206 non-coding downstream 27270 16407616 ~ 16407830 (-)
G679102 NA non-coding upstream 23001 16458300 ~ 16458794 (-)
G679104 NA non-coding upstream 26185 16461484 ~ 16461865 (-)
G679105 NA non-coding upstream 26623 16461922 ~ 16462154 (-)
G679107 NA non-coding upstream 27529 16462828 ~ 16463052 (-)
G679087 NA other downstream 2086 16432621 ~ 16433014 (-)
G676635 LOC106571254 other downstream 1918572 14508329 ~ 14516528 (-)
G676178 NA other downstream 2146755 14287849 ~ 14288345 (-)
G676077 NA other downstream 2227475 14206987 ~ 14207625 (-)
G675834 LOC106571238 other downstream 2448992 13983626 ~ 13986108 (-)
G679210 LOC106571290 other upstream 189791 16625090 ~ 16630259 (-)
G679471 NA other upstream 678244 17113543 ~ 17114528 (-)
G681659 NA other upstream 2355931 18791230 ~ 18792137 (-)
G684844 NA other upstream 5043467 21478766 ~ 21479203 (-)
LOC110529207 sprtn other upstream 5485128 21920427 ~ 21926307 (-)

Expression


G679089 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G679089 Expression in each Bioproject

Bar chart with 18 bars.
G679089 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network