G679107



Basic Information


Item Value
gene id G679107
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 16462828 ~ 16463052 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU773531
CCGTCATCTAATCAACTAGGAGAGTGTTTCCAATCCAACCCAATTCACGTTCAGTCTCAAAATGCCAAATCCTTCTCTGAGCTCTACCTGGGCCAAGGTACACAGCGCCCGGGAGGCAGAAGGCACCATTTCAAATTGACATTATTGGAGCTCATTGCAGTGGGGTTGCAATGGAACTGCTTCCAGAGCAGGAATAATAAAGGGGATGAGATCTGTAATGGGACT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU773531 True 225 lncRNA 0.48 1 16462828 16463052

Neighbor


gene id symbol gene type direction distance location
LOC110529495 LOC106571286 coding downstream 17815 16439558 ~ 16445013 (-)
LOC100499588 LOC100499588 coding downstream 36323 16424860 ~ 16426505 (-)
gjb7 LOC106571283 coding downstream 76183 16383314 ~ 16386645 (-)
LOC118965674 NA coding downstream 174196 16288561 ~ 16288632 (-)
LOC118965673 NA coding downstream 174443 16288314 ~ 16288385 (-)
LOC118965497 NA coding upstream 4367 16467419 ~ 16505761 (-)
LOC110529498 LOC106571289 coding upstream 176794 16639846 ~ 16674144 (-)
LOC110529499 LOC106571292 coding upstream 222709 16685761 ~ 16720691 (-)
LOC110529501 LOC106571293 coding upstream 258110 16721162 ~ 16758117 (-)
LOC110529503 lyrm2 coding upstream 362967 16825797 ~ 16830629 (-)
G679105 NA non-coding downstream 674 16461922 ~ 16462154 (-)
G679104 NA non-coding downstream 963 16461484 ~ 16461865 (-)
G679102 NA non-coding downstream 4034 16458300 ~ 16458794 (-)
G679089 NA non-coding downstream 27529 16435100 ~ 16435299 (-)
G679081 NA non-coding downstream 50928 16411648 ~ 16411900 (-)
G679332 NA non-coding upstream 355879 16818931 ~ 16821129 (-)
G679364 NA non-coding upstream 439201 16902253 ~ 16910145 (-)
LOC110529508 LOC106571332 non-coding upstream 462860 16925897 ~ 17037936 (-)
G679087 NA other downstream 29814 16432621 ~ 16433014 (-)
G676635 LOC106571254 other downstream 1946300 14508329 ~ 14516528 (-)
G676178 NA other downstream 2174483 14287849 ~ 14288345 (-)
G676077 NA other downstream 2255203 14206987 ~ 14207625 (-)
G675834 LOC106571238 other downstream 2476720 13983626 ~ 13986108 (-)
G679210 LOC106571290 other upstream 162038 16625090 ~ 16630259 (-)
G679471 NA other upstream 650491 17113543 ~ 17114528 (-)
G681659 NA other upstream 2328178 18791230 ~ 18792137 (-)
G684844 NA other upstream 5015714 21478766 ~ 21479203 (-)
LOC110529207 sprtn other upstream 5457375 21920427 ~ 21926307 (-)

Expression


G679107 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G679107 Expression in each Bioproject

Bar chart with 5 bars.
G679107 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network