G684714



Basic Information


Item Value
gene id G684714
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 21276176 ~ 21276701 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU779705
CCTTTACGAAGGTCTTGTTGTGCTGCATGAATTACAGGTGATGAAGGTGTCTAACTGATATATGGATGCACTTTATTTACTTATAACATCAACGGTTGATTTGCTACAAACAAGCCAGACACGGTGCTATTGTACAGAATATAGCAGCTGTTGGTTAACTAGTAGGAGTAAGCCAGACAGGGTGCTATTGTACAGAATATAGCAGCTGTAGGTTAACTAGTAGGAGTAAGCCAGACAGGGTGCTATTGTACAGCATATAGCAGCTGTAGGTTAACTAGTAGGAGTAAGCCAGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU779705 True 294 lncRNA 0.41 2 21276176 21276701
Loading

Neighbor


gene id symbol gene type direction distance location
si:dkeyp-114g9.1 fbos coding downstream 35026 21231292 ~ 21241150 (-)
LOC110529586 NA coding downstream 78978 21187530 ~ 21197198 (-)
LOC118965500 NA coding downstream 623632 20650227 ~ 20652544 (-)
LOC118965600 NA coding downstream 628647 20644656 ~ 20647529 (-)
LOC110529578 cx32 coding downstream 631978 20642316 ~ 20644198 (-)
LOC110529588 ngbr coding upstream 115637 21392338 ~ 21401110 (-)
LOC110529589 LOC106571387 coding upstream 125242 21401943 ~ 21406071 (-)
LOC110529592 LOC106571389 coding upstream 148918 21425619 ~ 21469294 (-)
LOC110529593 LOC106571390 coding upstream 222764 21499465 ~ 21504647 (-)
LOC110529205 LOC106571539 coding upstream 263181 21539882 ~ 21545761 (-)
G684268 NA non-coding downstream 267551 21008334 ~ 21008625 (-)
G684258 NA non-coding downstream 277379 20998486 ~ 20998797 (-)
G684247 NA non-coding downstream 283887 20990098 ~ 20992289 (-)
G684015 NA non-coding downstream 454789 20821152 ~ 20821387 (-)
G684690 NA non-coding upstream 11051 21287752 ~ 21291905 (-)
G684789 NA non-coding upstream 107217 21383918 ~ 21384286 (-)
G684791 NA non-coding upstream 110429 21387130 ~ 21387516 (-)
G684792 NA non-coding upstream 111115 21387816 ~ 21388049 (-)
G681659 NA other downstream 2484039 18791230 ~ 18792137 (-)
G679471 NA other downstream 4161648 17113543 ~ 17114528 (-)
G679210 LOC106571290 other downstream 4645917 16625090 ~ 16630259 (-)
G679087 NA other downstream 4843162 16432621 ~ 16433014 (-)
G676635 LOC106571254 other downstream 6759648 14508329 ~ 14516528 (-)
G684844 NA other upstream 202065 21478766 ~ 21479203 (-)
LOC110529207 sprtn other upstream 643726 21920427 ~ 21926307 (-)
G685953 NA other upstream 882329 22159030 ~ 22161042 (-)
LOC110529643 LOC106571435 other upstream 2340206 23614938 ~ 23659111 (-)
G687890 NA other upstream 2358608 23635309 ~ 23637408 (-)

Expression


G684714 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G684714 Expression in each Bioproject

Bar chart with 7 bars.
G684714 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network