G684792



Basic Information


Item Value
gene id G684792
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 21387816 ~ 21388049 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU779806
CACAAATCACATCATGAAACAGAAATAAACATAAATTGCTTACATTCTGAGTAATTACTGTTTTCTTCTGCATTTCATGCTGCGACCAAAATAGAGGAAGAAGAACATCCAGCATAGTTAAATATAGTCAGATATTTATAAAGTAAAGTAAGTCCATTTGTACACATATGGCCCCGGGAGTACCCCCCATATCAGGAATACAAGGCCAAAGCTGTTCCATTGTCTCTAAGTCCG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU779806 True 234 lncRNA 0.37 1 21387816 21388049
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529587 LOC106571386 coding downstream 2213 21247152 ~ 21385603 (-)
si:dkeyp-114g9.1 fbos coding downstream 146666 21231292 ~ 21241150 (-)
LOC110529586 NA coding downstream 190618 21187530 ~ 21197198 (-)
LOC118965500 NA coding downstream 735272 20650227 ~ 20652544 (-)
LOC118965600 NA coding downstream 740287 20644656 ~ 20647529 (-)
LOC110529588 ngbr coding upstream 4289 21392338 ~ 21401110 (-)
LOC110529589 LOC106571387 coding upstream 13894 21401943 ~ 21406071 (-)
LOC110529592 LOC106571389 coding upstream 37570 21425619 ~ 21469294 (-)
LOC110529593 LOC106571390 coding upstream 111416 21499465 ~ 21504647 (-)
LOC110529205 LOC106571539 coding upstream 151833 21539882 ~ 21545761 (-)
G684791 NA non-coding downstream 300 21387130 ~ 21387516 (-)
G684789 NA non-coding downstream 3530 21383918 ~ 21384286 (-)
G684690 NA non-coding downstream 95911 21287752 ~ 21291905 (-)
G684714 NA non-coding downstream 111115 21276176 ~ 21276701 (-)
G684767 NA non-coding upstream 33745 21421794 ~ 21424539 (-)
G684837 NA non-coding upstream 83566 21471615 ~ 21471826 (-)
G684863 NA non-coding upstream 103241 21491290 ~ 21491572 (-)
G684864 NA non-coding upstream 103660 21491709 ~ 21491926 (-)
G681659 NA other downstream 2595679 18791230 ~ 18792137 (-)
G679471 NA other downstream 4273288 17113543 ~ 17114528 (-)
G679210 LOC106571290 other downstream 4757557 16625090 ~ 16630259 (-)
G679087 NA other downstream 4954802 16432621 ~ 16433014 (-)
G676635 LOC106571254 other downstream 6871288 14508329 ~ 14516528 (-)
G684844 NA other upstream 90717 21478766 ~ 21479203 (-)
LOC110529207 sprtn other upstream 532378 21920427 ~ 21926307 (-)
G685953 NA other upstream 770981 22159030 ~ 22161042 (-)
LOC110529643 LOC106571435 other upstream 2228858 23614938 ~ 23659111 (-)
G687890 NA other upstream 2247260 23635309 ~ 23637408 (-)

Expression


G684792 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G684792 Expression in each Bioproject

Bar chart with 4 bars.
G684792 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network