G692424



Basic Information


Item Value
gene id G692424
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 28069900 ~ 28070228 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU788261
GTTGGTGGTGACGATGGCGAACATCCTCTGCAGGAAGCGGAAGTAGATCTGGTCGGCGGAAACAACACGGGGCAGGCAGGCATAGCGTTGCAGCAGTCTCTCATGCACCCGCCAGCGGAGCGACAAGGCAGCCTTCTGCTCGGCCGCTGCCAGCGCCGGGACCAGCTCGGGGACAATCAGCTGCTGGACCCACCATCGGGAGGGAGGGGAGACCGGTGGGAGAGAGAAATGAAGACGGGCATGGAGGAAGGGGGAGGCACAAAGTGTATAAGAAAGAAGGGTGAGGTTGAGTGGAAGGAGAGAAAAAAGGCATTGAGGAGGTGGGGTAG

Function


NR:

description
serine/threonine-protein phosphatase 4 regulatory subunit 4 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU788261 True 329 TUCP 0.60 1 28069900 28070228
Loading

Neighbor


gene id symbol gene type direction distance location
serpina10a LOC106571703 coding upstream 19466 28032401 ~ 28050434 (+)
LOC110529731 klc1 coding upstream 68994 27976743 ~ 28000906 (+)
xrcc3 xrcc3 coding upstream 99070 27951635 ~ 27972016 (+)
LOC110529728 LOC106571709 coding upstream 121849 27931501 ~ 27948051 (+)
btbd6b LOC106571711 coding upstream 155337 27909705 ~ 27914563 (+)
asb2a.2 LOC106571697 coding downstream 145972 28216200 ~ 28224790 (+)
LOC110529736 LOC106571696 coding downstream 166425 28236653 ~ 28266785 (+)
LOC110529737 NA coding downstream 212022 28282250 ~ 28295030 (+)
LOC110529738 LOC106571695 coding downstream 231140 28301368 ~ 28314736 (+)
btbd7 btbd7 coding downstream 424876 28495104 ~ 28605625 (+)
G692422 NA non-coding upstream 606 28069008 ~ 28069294 (+)
G692381 ppp4r4 non-coding upstream 971 27998056 ~ 28068929 (+)
G692333 NA non-coding upstream 96056 27972525 ~ 27973844 (+)
G692367 NA non-coding upstream 140428 27929266 ~ 27929472 (+)
G692464 NA non-coding downstream 52349 28122577 ~ 28123405 (+)
G692465 NA non-coding downstream 53300 28123528 ~ 28123934 (+)
G692480 NA non-coding downstream 80611 28150839 ~ 28151041 (+)
G692486 NA non-coding downstream 85739 28155967 ~ 28156190 (+)
G692343 LOC106571710 other upstream 173913 27895701 ~ 27895987 (+)
jag2b LOC106571712 other upstream 512881 27498161 ~ 27602164 (+)
LOC110529706 LOC106571495 other upstream 1686474 26381097 ~ 26393547 (+)
LOC110529702 LOC106607944 other upstream 1874356 26133191 ~ 26195544 (+)
G693207 NA other downstream 634622 28704850 ~ 28705752 (+)
cdca4 LOC106571684 other downstream 860532 28930668 ~ 28939888 (+)
G694036 NA other downstream 1720769 29790997 ~ 29792747 (+)
G699605 NA other downstream 6057365 34127593 ~ 34128301 (+)

Expression


G692424 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G692424 Expression in each Bioproject

Bar chart with 5 bars.
G692424 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network