G694818



Basic Information


Item Value
gene id G694818
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 30144707 ~ 30144980 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU790904
GTCTTGAATTTGAGTGATGGACTCAACGTGGAGCATTGAAGGCTGTCTTTCCAAATTATGGGTTGTGTAACATTGATAGTAGGGGTTTTGTTTTACCATGTTATCAGAATTATAATACTAAAGCGCATCAATGCATATGGCTTTCTGGATGATACAGTACAATTGACTTGAGCATGTTTTAGTATGTTTATAACTATGTAAGTGGACTAACCGTAGTGACTAACGTGTTGTGGGTTAGATAGAGTGATTTATGTGCAAGTATATTTGTAGCCGA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU790904 True 274 lncRNA 0.36 1 30144707 30144980
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529762 LOC100136382 coding upstream 174586 29939109 ~ 29970121 (+)
LOC110529758 LOC106571678 coding upstream 277132 29340904 ~ 29867575 (+)
si:dkey-177p2.6 LOC106571683 coding upstream 1176959 28951530 ~ 28967748 (+)
cdca4 LOC106571684 coding upstream 1204819 28930668 ~ 28939888 (+)
LOC110529754 gp132 coding upstream 1228573 28889319 ~ 28916134 (+)
LOC110529765 LOC106571674 coding downstream 5008 30149988 ~ 30158324 (+)
LOC110529766 LOC107589657 coding downstream 23141 30168121 ~ 30173329 (+)
LOC110529767 LOC107396020 coding downstream 30759 30175739 ~ 30190971 (+)
LOC110529768 LOC106571670 coding downstream 82429 30227409 ~ 30243300 (+)
LOC110529770 LOC106571673 coding downstream 106486 30251466 ~ 30263484 (+)
G694817 NA non-coding upstream 14 30143941 ~ 30144693 (+)
G694816 NA non-coding upstream 2493 30141956 ~ 30142214 (+)
G694815 NA non-coding upstream 3395 30141092 ~ 30141312 (+)
G694814 NA non-coding upstream 3953 30140480 ~ 30140754 (+)
G694813 LOC106581475 non-coding upstream 6939 30137542 ~ 30137768 (+)
G694819 NA non-coding downstream 286 30145266 ~ 30145467 (+)
G694986 NA non-coding downstream 56486 30201466 ~ 30201774 (+)
G694970 LOC107693096 non-coding downstream 77407 30222387 ~ 30222914 (+)
G695005 LOC106571669 non-coding downstream 124546 30269526 ~ 30272291 (+)
G694036 NA other upstream 351960 29790997 ~ 29792747 (+)
G693207 NA other upstream 1438955 28704850 ~ 28705752 (+)
btbd7 btbd7 other upstream 1586334 28495104 ~ 28605625 (+)
G692424 NA other upstream 2074479 28069900 ~ 28070228 (+)
G699605 NA other downstream 3982613 34127593 ~ 34128301 (+)
LOC110529856 LOC106571576 other downstream 5309868 35454437 ~ 35462086 (+)
G700685 NA other downstream 5468184 35613164 ~ 35614666 (+)
G700864 NA other downstream 5759069 35904049 ~ 35904698 (+)
G702415 NA other downstream 6555458 36700438 ~ 36700739 (+)

Expression


G694818 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G694818 Expression in each Bioproject

Bar chart with 11 bars.
G694818 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network