G695021



Basic Information


Item Value
gene id G695021
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 30300050 ~ 30386665 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU791149
tctgcctgcctgcctgtctgcctgcctgcctgtctgcctgcctgcctgcctgcctgcctgcctgcctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtgtctgtgtgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtctgtgtctgtgtgtctgtgtgtgt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU791149 True 239 lncRNA 0.56 3 30300050 30386665
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529770 LOC106571673 coding upstream 36566 30251466 ~ 30263484 (+)
LOC110529768 LOC106571670 coding upstream 56750 30227409 ~ 30243300 (+)
LOC110529767 LOC107396020 coding upstream 109079 30175739 ~ 30190971 (+)
LOC110529766 LOC107589657 coding upstream 126721 30168121 ~ 30173329 (+)
LOC110529765 LOC106571674 coding upstream 141726 30149988 ~ 30158324 (+)
LOC118965506 NA coding downstream 268956 30655621 ~ 30665458 (+)
LOC110529772 LOC106571664 coding downstream 422824 30809489 ~ 30878195 (+)
ndufb1 NA coding downstream 657362 31044027 ~ 31047423 (+)
LOC110529776 LOC106571659 coding downstream 668545 31055210 ~ 31097963 (+)
LOC110529228 LOC106571658 coding downstream 742845 31129510 ~ 31140471 (+)
G695022 NA non-coding upstream 2968 30296665 ~ 30297082 (+)
G695018 NA non-coding upstream 6863 30292554 ~ 30293187 (+)
G695005 LOC106571669 non-coding upstream 27759 30269526 ~ 30272291 (+)
G694970 LOC107693096 non-coding upstream 77136 30222387 ~ 30222914 (+)
G694986 NA non-coding upstream 98276 30201466 ~ 30201774 (+)
G695195 NA non-coding downstream 33259 30419924 ~ 30420124 (+)
G695218 NA non-coding downstream 50095 30436760 ~ 30436972 (+)
G695234 NA non-coding downstream 59655 30446320 ~ 30446547 (+)
G695238 NA non-coding downstream 63180 30449845 ~ 30450127 (+)
G695283 NA non-coding downstream 137433 30524098 ~ 30524334 (+)
G694036 NA other upstream 507303 29790997 ~ 29792747 (+)
cdca4 LOC106571684 other upstream 1361777 28930668 ~ 28939888 (+)
G693207 NA other upstream 1594298 28704850 ~ 28705752 (+)
btbd7 btbd7 other upstream 1741677 28495104 ~ 28605625 (+)
G692424 NA other upstream 2229822 28069900 ~ 28070228 (+)
G699605 NA other downstream 3740928 34127593 ~ 34128301 (+)
LOC110529856 LOC106571576 other downstream 5068183 35454437 ~ 35462086 (+)
G700685 NA other downstream 5226499 35613164 ~ 35614666 (+)
G700864 NA other downstream 5517384 35904049 ~ 35904698 (+)
G702415 NA other downstream 6313773 36700438 ~ 36700739 (+)

Expression


G695021 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G695021 Expression in each Bioproject

Bar chart with 20 bars.
G695021 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network