G697762



Basic Information


Item Value
gene id G697762
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 32480686 ~ 32481255 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU794106
GAGCGATTTAAGTTAAGAGTTGTGATTCGCACATGCCTCTGTAACATCCTGTTCTGGAGGGTATAACATCCTGTTCTGGAGGGTATAACATCCTGTTCTGGAGGGTATAACCACAGACAGGTGCGCTGTGGAACTTGGAGCTGTTTCAGGTTGGCCCCATTTCCATGGGTCCCAGCCGTGACTTTGGTACGCCATGTTGGTATGATGTGACGATGAAGGAGATGAGCAGTTCGGGGTACCATTTGACTTGTTCAAATGCTTCTTTTTTAGGAACATTCAAACGAAGATAATTGGGGGCTCAACCTTTTAAGGTTTCCATAGAGCTAGTAAAGGCGGTGTTAGTACATTGAGGGGTACAATACTACCTTGTGCCTCTGGAAACATTGAGGCAGCGGTAGGGGACTATGCCCTCTGATTGTCTTATAGACGAGAACTATCTATGAGATGTTTGTGACATATAACACACATGAGGGTAAATGGTTTGATTTAGAACCATGTAGGAGAGTTTCGAGCTTAGCTTGTGTTAACCCCTCATATTGGGATAATGTAAGAAAACAGAATGGTCACAAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU794106 True 570 lncRNA 0.44 1 32480686 32481255

Neighbor


gene id symbol gene type direction distance location
LOC118965610 NA coding downstream 59601 32417472 ~ 32421085 (-)
LOC110529812 LOC106571726 coding downstream 158546 32306142 ~ 32322140 (-)
LOC110529806 LOC106571627 coding downstream 179393 32289064 ~ 32301293 (-)
LOC110529808 LOC106571628 coding downstream 193517 32286058 ~ 32287169 (-)
bpnt1 bpnt1 coding downstream 202452 32269095 ~ 32278234 (-)
LOC110531086 LOC106571620 coding upstream 81876 32563131 ~ 32569877 (-)
cep43 LOC106571617 coding upstream 88761 32570016 ~ 32589888 (-)
myt1la LOC106571614 coding upstream 109043 32590298 ~ 32638849 (-)
LOC110529818 rnaseh1 coding upstream 189490 32670745 ~ 32682526 (-)
LOC110529821 LOC106571616 coding upstream 496541 32977796 ~ 33011990 (-)
G697760 NA non-coding downstream 1379 32479001 ~ 32479307 (-)
G697758 NA non-coding downstream 2934 32477480 ~ 32477752 (-)
G697757 NA non-coding downstream 3262 32477147 ~ 32477424 (-)
G697756 LOC106608148 non-coding downstream 3680 32476766 ~ 32477006 (-)
G697751 NA non-coding downstream 9382 32471105 ~ 32471304 (-)
G697764 NA non-coding upstream 2570 32483825 ~ 32485355 (-)
G697773 NA non-coding upstream 16477 32497732 ~ 32497970 (-)
G697780 NA non-coding upstream 27836 32509091 ~ 32509306 (-)
G697781 NA non-coding upstream 30350 32511605 ~ 32518774 (-)
G697803 NA non-coding upstream 48377 32529632 ~ 32529990 (-)
LOC110529804 ypel5 other downstream 263137 32214451 ~ 32217572 (-)
LOC110529793 LOC106571728 other downstream 800951 31657632 ~ 31703525 (-)
G696499 NA other downstream 1002659 31477354 ~ 31478027 (-)
G696073 NA other downstream 1625279 30855107 ~ 30855407 (-)
G696068 NA other downstream 1633477 30846902 ~ 30847209 (-)
G697774 LOC106571626 other upstream 17544 32498799 ~ 32499410 (-)
G698356 NA other upstream 507990 32989245 ~ 32990061 (-)
G699468 NA other upstream 1461767 33943022 ~ 33952356 (-)
ankef1a LOC106571587 other upstream 1542036 34017010 ~ 34029131 (-)
G701454 NA other upstream 3101743 35582998 ~ 35589877 (-)

Expression


G697762 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G697762 Expression in each Bioproject

Bar chart with 9 bars.
G697762 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network