G698000 (allc)



Basic Information


Item Value
gene id G698000
gene name allc
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 32691962 ~ 32692607 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU794379
CCAATGAAATGATTGTCATTTTGTGTCTCTTCAAGTTATACCAGGTATTCTTTTCCTTCTCGTCTCCCAGCCGTCCATCCATTTTCCGTACTCGGTGAATGCAGACGCTATGAACTCTGGTGGCTCTCTCTTCAGAAGATTGCTAGCTGGTGCAAACCATTCGTCTGTCGCAAAAATAACATTTCCTCCAGCTGTCTCACAGGCCAGGTTATTAAACTGCAGAAAGTCTGGTTGACCACTGACAATTTTCACTGCTTTTCGGTCTGCCATTCTATTGCAGACTATAATTTACAATCCCGATATGTAACTCGATCCAGATTGAGAAAATAATTATCATTTACCTCATACAATAAGATAAATCTGCTTTTATATATTACAGCTTCCTGTACTTCCAAGTTTAAAAAAGCAGTCCACAACCACTAATGAATAGATTCTTCTGGTGC

Function


symbol description
allc Predicted to enable allantoicase activity. Predicted to be involved in allantoin catabolic process. Predicted to act upstream of or within purine nucleobase metabolic process. Orthologous to human ALLC (allantoicase).

NR:

description
probable allantoicase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU794379 True 443 lncRNA 0.40 3 32691962 32692607

Neighbor


gene id symbol gene type direction distance location
LOC110529818 rnaseh1 coding downstream 9436 32670745 ~ 32682526 (-)
myt1la LOC106571614 coding downstream 53113 32590298 ~ 32638849 (-)
cep43 LOC106571617 coding downstream 102074 32570016 ~ 32589888 (-)
LOC110531086 LOC106571620 coding downstream 122085 32563131 ~ 32569877 (-)
LOC118965610 NA coding downstream 270877 32417472 ~ 32421085 (-)
LOC110529821 LOC106571616 coding upstream 285189 32977796 ~ 33011990 (-)
LOC110529232 NA coding upstream 698370 33390977 ~ 33405852 (-)
LOC110529824 NA coding upstream 717196 33409803 ~ 33413009 (-)
LOC118965663 NA coding upstream 718259 33410866 ~ 33411152 (-)
ints9 ints9 coding upstream 733910 33426517 ~ 33435877 (-)
G697956 NA non-coding downstream 4108 32684787 ~ 32687854 (-)
G697993 NA non-coding downstream 26116 32665619 ~ 32665846 (-)
G697992 NA non-coding downstream 26711 32664948 ~ 32665251 (-)
G697966 NA non-coding downstream 109002 32581758 ~ 32582960 (-)
G697807 NA non-coding downstream 160123 32531613 ~ 32531839 (-)
G698076 NA non-coding upstream 96402 32789009 ~ 32789408 (-)
G698081 NA non-coding upstream 97880 32790487 ~ 32790714 (-)
G698102 NA non-coding upstream 112816 32805423 ~ 32805629 (-)
G698226 NA non-coding upstream 171760 32864367 ~ 32864740 (-)
G698269 NA non-coding upstream 237631 32930238 ~ 32930531 (-)
G697774 LOC106571626 other downstream 192552 32498799 ~ 32499410 (-)
LOC110529804 ypel5 other downstream 474413 32214451 ~ 32217572 (-)
LOC110529793 LOC106571728 other downstream 1012227 31657632 ~ 31703525 (-)
G696499 NA other downstream 1213935 31477354 ~ 31478027 (-)
G696073 NA other downstream 1836555 30855107 ~ 30855407 (-)
G698356 NA other upstream 296638 32989245 ~ 32990061 (-)
G699468 NA other upstream 1250415 33943022 ~ 33952356 (-)
ankef1a LOC106571587 other upstream 1330684 34017010 ~ 34029131 (-)
G701454 NA other upstream 2890391 35582998 ~ 35589877 (-)
LOC110529865 LOC106571568 other upstream 2948748 35633473 ~ 35705333 (-)

Expression



Co-expression Network