G699468



Basic Information


Item Value
gene id G699468
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 33943022 ~ 33952356 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU795919
gtgaggatctctgaatgatccaatgttgacctatatgactaatgatgataaatacaatccacctgtgtgtattcaagtatccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagaccagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactacaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacattcagtcgtatattgcacaaatctggcctttatgggagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagactcaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatacaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaata

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU795919 True 782 TUCP 0.43 2 33943022 33952356

Neighbor


gene id symbol gene type direction distance location
LOC110529836 LOC106571586 coding downstream 101420 33831672 ~ 33841602 (-)
cdc42bpab LOC106571585 coding downstream 120784 33719374 ~ 33822238 (-)
LOC110529832 fbxo16 coding downstream 253970 33685369 ~ 33689052 (-)
LOC110529828 LOC106571602 coding downstream 393714 33484801 ~ 33549308 (-)
LOC110529827 LOC106606921 coding downstream 484550 33454287 ~ 33458472 (-)
LOC110529840 LOC106571603 coding upstream 23132 33975488 ~ 34009377 (-)
ankef1a LOC106571587 coding upstream 64654 34017010 ~ 34029131 (-)
LOC110529846 LOC106571592 coding upstream 184202 34136558 ~ 34157637 (-)
LOC110529843 LOC105030678 coding upstream 303159 34255515 ~ 34257262 (-)
LOC110529848 LOC106571583 coding upstream 592800 34545156 ~ 34550128 (-)
G699457 NA non-coding downstream 55233 33887513 ~ 33887789 (-)
G699456 NA non-coding downstream 56089 33883703 ~ 33886933 (-)
G699451 NA non-coding downstream 70905 33871902 ~ 33872117 (-)
G699450 NA non-coding downstream 71163 33871655 ~ 33871859 (-)
G699445 LOC106571584 non-coding downstream 74800 33867743 ~ 33868222 (-)
G699474 NA non-coding upstream 317 33952673 ~ 33955182 (-)
G699476 NA non-coding upstream 3221 33955577 ~ 33955914 (-)
G699479 NA non-coding upstream 6215 33958571 ~ 33958856 (-)
G699480 NA non-coding upstream 6657 33959013 ~ 33959233 (-)
G699486 NA non-coding upstream 14779 33967135 ~ 33967427 (-)
G698356 NA other downstream 952961 32989245 ~ 32990061 (-)
G697774 LOC106571626 other downstream 1443612 32498799 ~ 32499410 (-)
LOC110529804 ypel5 other downstream 1725473 32214451 ~ 32217572 (-)
LOC110529793 LOC106571728 other downstream 2263287 31657632 ~ 31703525 (-)
G696499 NA other downstream 2464995 31477354 ~ 31478027 (-)
G701454 NA other upstream 1630642 35582998 ~ 35589877 (-)
LOC110529865 LOC106571568 other upstream 1688999 35633473 ~ 35705333 (-)
G701618 LOC106571560 other upstream 1948267 35900623 ~ 35918175 (-)
LOC110529880 LOC106571768 other upstream 3402740 37355096 ~ 37361922 (-)

Expression


G699468 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G699468 Expression in each Bioproject

Bar chart with 20 bars.
G699468 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network