G699803



Basic Information


Item Value
gene id G699803
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 34274350 ~ 34274640 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU796289
tgcgagcaaggaggcctacaaacctgactcagttacaccagctctgtcaggaggaatgggccaaaattcactcaacttattgtgggaagcttgtggaaggctacccgaaatgtttgaccaaagttaaacaatttaaagcaatgctaccaagtactaattgagtgtatgtaatcttctgacccactgggaatgtgttaaaagaaataaaagctgaaataaatcattctctctactattattctgacatttcacattcttaaaataaagtggtgatcctaactgacataaaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU796289 True 291 lncRNA 0.38 1 34274350 34274640
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529843 LOC105030678 coding downstream 17088 34255515 ~ 34257262 (-)
LOC110529846 LOC106571592 coding downstream 116713 34136558 ~ 34157637 (-)
ankef1a LOC106571587 coding downstream 245219 34017010 ~ 34029131 (-)
LOC110529840 LOC106571603 coding downstream 264973 33975488 ~ 34009377 (-)
LOC110529836 LOC106571586 coding downstream 432748 33831672 ~ 33841602 (-)
LOC110529848 LOC106571583 coding upstream 270516 34545156 ~ 34550128 (-)
LOC118965512 NA coding upstream 523205 34797845 ~ 34799304 (-)
LOC110529850 fau coding upstream 1027914 35302554 ~ 35304730 (-)
LOC110529851 prpf39 coding upstream 1032288 35306928 ~ 35321805 (-)
LOC110529854 LOC106571577 coding upstream 1151676 35426316 ~ 35429137 (-)
G699757 NA non-coding downstream 84956 34189066 ~ 34189394 (-)
G699755 NA non-coding downstream 89499 34184332 ~ 34184851 (-)
G699730 hs90a non-coding downstream 96740 34171056 ~ 34177610 (-)
G699592 NA non-coding downstream 156459 34117662 ~ 34117891 (-)
G699582 NA non-coding downstream 164062 34109793 ~ 34110288 (-)
G699866 NA non-coding upstream 102908 34377548 ~ 34377783 (-)
G699868 LOC107678310 non-coding upstream 105267 34379907 ~ 34380295 (-)
G699871 NA non-coding upstream 108008 34382648 ~ 34382888 (-)
G699872 NA non-coding upstream 108287 34382927 ~ 34383463 (-)
G699873 NA non-coding upstream 115023 34389663 ~ 34393886 (-)
G699468 NA other downstream 321994 33943022 ~ 33952356 (-)
G698356 NA other downstream 1284289 32989245 ~ 32990061 (-)
G697774 LOC106571626 other downstream 1774940 32498799 ~ 32499410 (-)
LOC110529804 ypel5 other downstream 2056801 32214451 ~ 32217572 (-)
G701454 NA other upstream 1308358 35582998 ~ 35589877 (-)
LOC110529865 LOC106571568 other upstream 1366715 35633473 ~ 35705333 (-)
G701618 LOC106571560 other upstream 1625983 35900623 ~ 35918175 (-)
LOC110529880 LOC106571768 other upstream 3080456 37355096 ~ 37361922 (-)
LOC110530908 otof other upstream 3214587 37474229 ~ 37626960 (-)

Expression


G699803 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G699803 Expression in each Bioproject

Bar chart with 18 bars.
G699803 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network