G699960



Basic Information


Item Value
gene id G699960
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 34611874 ~ 34612206 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU796494
cagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaacgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaattgaatggttcaaaaataaacatatccaggtgttagaatggccaagtcagtccagacctgaatccaatcgagaatctgtggaaagaactgaaatctgctgttcacaaatgctctccatccaacctcactgaaatttcagtctctcgatgtgcaaaactgatagagacataccc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU796494 True 310 lncRNA 0.42 2 34611874 34612206
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529849 NA coding upstream 55805 34553792 ~ 34557596 (+)
LOC110529842 LOC106571600 coding upstream 224838 34374736 ~ 34387036 (+)
LOC110529847 LOC106571593 coding upstream 393195 34178297 ~ 34218679 (+)
LOC110529844 hs90a coding upstream 434265 34167070 ~ 34177609 (+)
LOC110529845 LOC106571588 coding upstream 445160 34158968 ~ 34166714 (+)
LOC110529233 LOC106571582 coding downstream 187109 34799315 ~ 35163860 (+)
LOC100653435 fkbp3 coding downstream 682821 35295027 ~ 35318460 (+)
LOC110529852 arf6 coding downstream 724773 35336979 ~ 35340123 (+)
LOC110529853 LOC106571579 coding downstream 756496 35368702 ~ 35385937 (+)
LOC110529856 LOC106571576 coding downstream 842231 35454437 ~ 35462086 (+)
G699894 NA non-coding upstream 84679 34525591 ~ 34527195 (+)
G699890 NA non-coding upstream 86471 34517276 ~ 34525403 (+)
G699895 NA non-coding upstream 103083 34507185 ~ 34508791 (+)
G699878 NA non-coding upstream 212056 34398665 ~ 34399818 (+)
G700036 LOC107756720 non-coding downstream 25768 34637974 ~ 34638200 (+)
G700040 NA non-coding downstream 32197 34644403 ~ 34644615 (+)
G700054 NA non-coding downstream 40111 34652317 ~ 34652533 (+)
G700072 NA non-coding downstream 54215 34666421 ~ 34666849 (+)
G700129 NA non-coding downstream 95560 34707766 ~ 34708037 (+)
G699605 NA other upstream 483573 34127593 ~ 34128301 (+)
G694036 NA other upstream 4819127 29790997 ~ 29792747 (+)
cdca4 LOC106571684 other upstream 5673601 28930668 ~ 28939888 (+)
G693207 NA other upstream 5906122 28704850 ~ 28705752 (+)
btbd7 btbd7 other upstream 6053501 28495104 ~ 28605625 (+)
G700685 NA other downstream 1000958 35613164 ~ 35614666 (+)
G700864 NA other downstream 1291843 35904049 ~ 35904698 (+)
G702415 NA other downstream 2088232 36700438 ~ 36700739 (+)
G702687 NA other downstream 2446139 37058345 ~ 37059223 (+)

Expression


G699960 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G699960 Expression in each Bioproject

Bar chart with 18 bars.
G699960 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network