G701204



Basic Information


Item Value
gene id G701204
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 35187594 ~ 35188003 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU797826
ctctgctgtttcctgaagtccacaatcatctccttagttttgttgacgttgagtgtgaggttattttcctgacaccacactccgagggccctcacctcctccctgtaggccgtctcgtcgttgttggtaatcaagcctaccactgttgtgtcatccgcaaacttgatgattgagttggaggcgtgcgtggccacgcagtcgtgggtgaacagggagtacaggagagggctcagaacgcacccttgtggggccccagtgttgaggatcagcggggtggagatgttgttgcctaccctcaccacctgggggcggcctgtcaggaagtccagtacccagttgcacagggcggggtcgagacccagggtctcgagcttgatgacgagcttggagggtactatggtgttaaatgc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU797826 True 410 lncRNA 0.56 1 35187594 35188003

Neighbor


gene id symbol gene type direction distance location
LOC118965512 NA coding downstream 388290 34797845 ~ 34799304 (-)
LOC110529848 LOC106571583 coding downstream 637466 34545156 ~ 34550128 (-)
LOC110529843 LOC105030678 coding downstream 930332 34255515 ~ 34257262 (-)
LOC110529846 LOC106571592 coding downstream 1029957 34136558 ~ 34157637 (-)
ankef1a LOC106571587 coding downstream 1158463 34017010 ~ 34029131 (-)
LOC110529850 fau coding upstream 114551 35302554 ~ 35304730 (-)
LOC110529851 prpf39 coding upstream 118925 35306928 ~ 35321805 (-)
LOC110529854 LOC106571577 coding upstream 238313 35426316 ~ 35429137 (-)
LOC110529855 LOC106571575 coding upstream 274270 35462273 ~ 35473852 (-)
LOC110529861 LOC106571572 coding upstream 349686 35537689 ~ 35546844 (-)
G701190 NA non-coding downstream 14076 35173298 ~ 35173518 (-)
G701151 NA non-coding downstream 68830 35110954 ~ 35118764 (-)
G701052 LOC106571582 non-coding downstream 204817 34966530 ~ 34982777 (-)
G700118 NA non-coding downstream 486344 34700992 ~ 34701250 (-)
G700111 NA non-coding downstream 489945 34697314 ~ 34697649 (-)
G701291 NA non-coding upstream 101146 35289149 ~ 35295336 (-)
G701353 NA non-coding upstream 222938 35410941 ~ 35411158 (-)
G701362 NA non-coding upstream 270049 35458052 ~ 35502645 (-)
LOC110529862 LOC106571571 non-coding upstream 365218 35553221 ~ 35608497 (-)
G701395 NA non-coding upstream 472347 35660350 ~ 35679252 (-)
G699468 NA other downstream 1235238 33943022 ~ 33952356 (-)
G698356 NA other downstream 2197533 32989245 ~ 32990061 (-)
G697774 LOC106571626 other downstream 2688184 32498799 ~ 32499410 (-)
LOC110529804 ypel5 other downstream 2970045 32214451 ~ 32217572 (-)
G701454 NA other upstream 394995 35582998 ~ 35589877 (-)
LOC110529865 LOC106571568 other upstream 453352 35633473 ~ 35705333 (-)
G701618 LOC106571560 other upstream 712620 35900623 ~ 35918175 (-)
LOC110529880 LOC106571768 other upstream 2167093 37355096 ~ 37361922 (-)
LOC110530908 otof other upstream 2301224 37474229 ~ 37626960 (-)

Expression


G701204 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G701204 Expression in each Bioproject

Bar chart with 20 bars.
G701204 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network