G701353



Basic Information


Item Value
gene id G701353
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 35410941 ~ 35411158 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU797994
ccttcgtacatcagctgatatctcaaagtgctgtacagaaacccagcctaaaaccccaaacagcaagcaatgcaggtgtagaagcacggtggctaggaaaaactccttagaaacgccagaacctaggaagaaacctagagaggaaccaggctctgaggggtggccagtcctcttctggctgtgccgggtggagattataacagagaatggccaagatg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU797994 True 218 lncRNA 0.50 1 35410941 35411158
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529851 prpf39 coding downstream 89136 35306928 ~ 35321805 (-)
LOC110529850 fau coding downstream 106211 35302554 ~ 35304730 (-)
LOC118965512 NA coding downstream 611637 34797845 ~ 34799304 (-)
LOC110529848 LOC106571583 coding downstream 860813 34545156 ~ 34550128 (-)
LOC110529843 LOC105030678 coding downstream 1153679 34255515 ~ 34257262 (-)
LOC110529854 LOC106571577 coding upstream 15158 35426316 ~ 35429137 (-)
LOC110529855 LOC106571575 coding upstream 51115 35462273 ~ 35473852 (-)
LOC110529861 LOC106571572 coding upstream 126531 35537689 ~ 35546844 (-)
LOC110529862 LOC106571571 coding upstream 142250 35553221 ~ 35608497 (-)
LOC110529864 LOC106571569 coding upstream 216994 35628152 ~ 35632437 (-)
G701291 NA non-coding downstream 115605 35289149 ~ 35295336 (-)
G701204 NA non-coding downstream 222938 35187594 ~ 35188003 (-)
G701190 NA non-coding downstream 237423 35173298 ~ 35173518 (-)
G701151 NA non-coding downstream 292177 35110954 ~ 35118764 (-)
G701052 LOC106571582 non-coding downstream 428164 34966530 ~ 34982777 (-)
G701362 NA non-coding upstream 46894 35458052 ~ 35502645 (-)
G701395 NA non-coding upstream 249192 35660350 ~ 35679252 (-)
G701486 NA non-coding upstream 310915 35722073 ~ 35722772 (-)
G701522 NA non-coding upstream 321083 35732241 ~ 35732648 (-)
ankef1a LOC106571587 other downstream 1387056 34017010 ~ 34029131 (-)
G699468 NA other downstream 1458585 33943022 ~ 33952356 (-)
G698356 NA other downstream 2420880 32989245 ~ 32990061 (-)
G697774 LOC106571626 other downstream 2911531 32498799 ~ 32499410 (-)
LOC110529804 ypel5 other downstream 3193392 32214451 ~ 32217572 (-)
G701454 NA other upstream 171840 35582998 ~ 35589877 (-)
LOC110529865 LOC106571568 other upstream 230197 35633473 ~ 35705333 (-)
G701618 LOC106571560 other upstream 489465 35900623 ~ 35918175 (-)
LOC110529880 LOC106571768 other upstream 1943938 37355096 ~ 37361922 (-)
LOC110530908 otof other upstream 2078069 37474229 ~ 37626960 (-)

Expression


G701353 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G701353 Expression in each Bioproject

Bar chart with 18 bars.
G701353 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network