G702415



Basic Information


Item Value
gene id G702415
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 36700438 ~ 36700739 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU799161
agcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaagaaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaattgagaatctgtggaaagaactgaaaactgctgttcacaa

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU799161 True 302 TUCP 0.42 1 36700438 36700739
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110529878 LOC106571745 coding upstream 26169 36665592 ~ 36674269 (+)
gpcpd1 LOC106571744 coding upstream 37612 36642304 ~ 36662826 (+)
trmt6 trmt6 coding upstream 81428 36605568 ~ 36619010 (+)
fermt1 LOC106571740 coding upstream 95880 36588640 ~ 36604558 (+)
LOC118965513 NA coding upstream 232832 36464956 ~ 36467606 (+)
trib2 LOC106571747 coding downstream 57468 36758207 ~ 36767971 (+)
LOC110530907 LOC106571749 coding downstream 115859 36816598 ~ 37146833 (+)
mfsd2b LOC106571769 coding downstream 611992 37312731 ~ 37354860 (+)
fkbp1b fkbp1b coding downstream 664452 37365191 ~ 37384842 (+)
mut mut coding downstream 684433 37385172 ~ 37424189 (+)
G702387 NA non-coding upstream 70765 36629318 ~ 36629673 (+)
G701862 NA non-coding upstream 434345 36265238 ~ 36266093 (+)
G701837 LOC106571556 non-coding upstream 482236 36213665 ~ 36218202 (+)
G701642 NA non-coding upstream 622833 36052943 ~ 36077605 (+)
G701727 NA non-coding upstream 648418 36051754 ~ 36052020 (+)
G702416 NA non-coding downstream 2586 36703325 ~ 36703781 (+)
G702418 NA non-coding downstream 9514 36710253 ~ 36710500 (+)
G702419 NA non-coding downstream 10569 36711308 ~ 36711659 (+)
G702421 NA non-coding downstream 11899 36712638 ~ 36712911 (+)
G702459 NA non-coding downstream 78102 36778841 ~ 36779522 (+)
G700864 NA other upstream 795740 35904049 ~ 35904698 (+)
G700685 NA other upstream 1085772 35613164 ~ 35614666 (+)
LOC110529856 LOC106571576 other upstream 1238398 35454437 ~ 35462086 (+)
G699605 NA other upstream 2572137 34127593 ~ 34128301 (+)
G694036 NA other upstream 6907691 29790997 ~ 29792747 (+)
G702687 NA other downstream 357606 37058345 ~ 37059223 (+)
G702817 LOC106571770 other downstream 547998 37248737 ~ 37249809 (+)
G703835 LOC106584613 other downstream 1070125 37770864 ~ 37771635 (+)
G704281 NA other downstream 1525316 38226055 ~ 38229974 (+)
G705273 LOC100136012 other downstream 2055132 38755871 ~ 38756305 (+)

Expression


G702415 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G702415 Expression in each Bioproject

Bar chart with 18 bars.
G702415 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network