G704697



Basic Information


Item Value
gene id G704697
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 38030019 ~ 38030248 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU801605
ccagatcgagggagattatcagtggtcttgtatgtcttccatttcctaataattgctcccacagctgatttcttcaaaccaagctgcttacctattgcaaattcagtcttcccagcctggtgcaggtctacaattttgtttctggtctcctttgacagctctttggtcttggccatagtggagtttggagtgtgactgtttgaggttgtggacaggtgtcttttatacct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU801605 True 230 lncRNA 0.44 1 38030019 38030248
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531088 NA coding downstream 98056 37930118 ~ 37931963 (-)
LOC110530911 parp1 coding downstream 108608 37905170 ~ 37921411 (-)
LOC110530910 LOC106571760 coding downstream 150141 37859257 ~ 37879878 (-)
acbd3 LOC106571761 coding downstream 178175 37817872 ~ 37851844 (-)
sod2 sod2 coding downstream 237291 37782174 ~ 37792728 (-)
LOC110529892 LOC106571758 coding upstream 185597 38215845 ~ 38260820 (-)
LOC100136309 LOC100136309 coding upstream 254655 38284903 ~ 38302289 (-)
LOC110529893 LOC106571757 coding upstream 300445 38330693 ~ 38387308 (-)
trnal-uaa-3 NA coding upstream 409950 38440198 ~ 38440280 (-)
LOC110530913 NA coding upstream 757265 38787513 ~ 38801952 (-)
G704696 NA non-coding downstream 170 38029599 ~ 38029849 (-)
G704689 NA non-coding downstream 6241 38023532 ~ 38023778 (-)
G704154 NA non-coding downstream 94814 37934752 ~ 37935205 (-)
G704129 NA non-coding downstream 113518 37916028 ~ 37916501 (-)
G704114 NA non-coding downstream 126582 37903220 ~ 37903437 (-)
G704701 NA non-coding upstream 6109 38036357 ~ 38036719 (-)
G704703 NA non-coding upstream 8775 38039023 ~ 38039249 (-)
G704712 NA non-coding upstream 25329 38055577 ~ 38055799 (-)
G704727 NA non-coding upstream 46017 38076265 ~ 38076501 (-)
G704730 NA non-coding upstream 49154 38079402 ~ 38079619 (-)
LOC110530908 otof other downstream 537862 37474229 ~ 37626960 (-)
LOC110529880 LOC106571768 other downstream 668426 37355096 ~ 37361922 (-)
G701618 LOC106571560 other downstream 2111844 35900623 ~ 35918175 (-)
LOC110529865 LOC106571568 other downstream 2324706 35633473 ~ 35705333 (-)
G701454 NA other downstream 2440142 35582998 ~ 35589877 (-)
G704702 NA other upstream 7477 38037725 ~ 38038346 (-)
G704874 NA other upstream 283241 38313489 ~ 38313803 (-)
G706683 stxbp5 other upstream 1189396 39219644 ~ 39226313 (-)
slc22a16 LOC106571810 other upstream 1926713 39956961 ~ 40017167 (-)
G709272 NA other upstream 4689523 42719771 ~ 42720699 (-)

Expression


G704697 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G704697 Expression in each Bioproject

Bar chart with 10 bars.
G704697 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network