G704877



Basic Information


Item Value
gene id G704877
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 38315706 ~ 38316015 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU801793
ctgttgggctgtatcaccgcctggtacggcaactgctctgcccacaaccgtaaggctctccagagggtagtgaggtctgcacaacgcatcaccgggggcaaactacctgccctccaggacacctacaccacccgatgtcacaggaaggccataaagatcatcaaggacaacaaccacccgagccactgcctgttctccccgctatcatccagaaggcgaggtcagtacatgtgcatcaaagcagggactgagagactgaaaaacagcttcatctcaagaccatcagactgttaaacagccaccacaaaca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU801793 True 310 lncRNA 0.54 1 38315706 38316015
Loading

Neighbor


gene id symbol gene type direction distance location
LOC100136309 LOC100136309 coding downstream 13417 38284903 ~ 38302289 (-)
LOC110529892 LOC106571758 coding downstream 54886 38215845 ~ 38260820 (-)
LOC110531088 NA coding downstream 383743 37930118 ~ 37931963 (-)
LOC110530911 parp1 coding downstream 394295 37905170 ~ 37921411 (-)
LOC110530910 LOC106571760 coding downstream 435828 37859257 ~ 37879878 (-)
LOC110529893 LOC106571757 coding upstream 14678 38330693 ~ 38387308 (-)
trnal-uaa-3 NA coding upstream 124183 38440198 ~ 38440280 (-)
LOC110530913 NA coding upstream 471498 38787513 ~ 38801952 (-)
LOC118965515 NA coding upstream 506127 38822129 ~ 38826089 (-)
LOC110531091 NA coding upstream 734734 39050749 ~ 39053399 (-)
G704862 NA non-coding downstream 19645 38295787 ~ 38296061 (-)
G704855 NA non-coding downstream 34697 38280711 ~ 38281009 (-)
G704800 NA non-coding downstream 36171 38192006 ~ 38279535 (-)
G704806 NA non-coding downstream 85213 38226612 ~ 38230493 (-)
G704730 NA non-coding downstream 236087 38079402 ~ 38079619 (-)
G705135 NA non-coding upstream 341354 38657369 ~ 38657680 (-)
G705145 NA non-coding upstream 349475 38665490 ~ 38665706 (-)
G705254 NA non-coding upstream 425327 38741342 ~ 38741544 (-)
G705261 NA non-coding upstream 429861 38745876 ~ 38746078 (-)
G705266 NA non-coding upstream 432999 38749014 ~ 38749394 (-)
G704874 NA other downstream 1903 38313489 ~ 38313803 (-)
G704702 NA other downstream 277360 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 823549 37474229 ~ 37626960 (-)
LOC110529880 LOC106571768 other downstream 954113 37355096 ~ 37361922 (-)
G701618 LOC106571560 other downstream 2397531 35900623 ~ 35918175 (-)
G706683 stxbp5 other upstream 903629 39219644 ~ 39226313 (-)
slc22a16 LOC106571810 other upstream 1640946 39956961 ~ 40017167 (-)
G709272 NA other upstream 4403756 42719771 ~ 42720699 (-)
G709454 NA other upstream 4854745 43170760 ~ 43171082 (-)
G711133 NA other upstream 6222778 44538793 ~ 44539504 (-)

Expression


G704877 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G704877 Expression in each Bioproject

Bar chart with 19 bars.
G704877 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network