G705145



Basic Information


Item Value
gene id G705145
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 38665490 ~ 38665706 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU802080
ccctgtcatctcagattttcaaaatatgctttacagccaaagctagacaagcatttgtgtaagtttatcgatagcctagcatagcattttgtccagctagcagcaggtaacttggtcacggaaatcagaaaagcaatcaaattaaatagtttacctttgatgagcttcggatgttttcactcacgagactcccagttagatagcaaatgttcctttt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU802080 True 217 lncRNA 0.39 1 38665490 38665706
Loading

Neighbor


gene id symbol gene type direction distance location
trnal-uaa-3 NA coding downstream 225210 38440198 ~ 38440280 (-)
LOC110529893 LOC106571757 coding downstream 278182 38330693 ~ 38387308 (-)
LOC100136309 LOC100136309 coding downstream 363201 38284903 ~ 38302289 (-)
LOC110529892 LOC106571758 coding downstream 404670 38215845 ~ 38260820 (-)
LOC110531088 NA coding downstream 733527 37930118 ~ 37931963 (-)
LOC110530913 NA coding upstream 121807 38787513 ~ 38801952 (-)
LOC118965515 NA coding upstream 156436 38822129 ~ 38826089 (-)
LOC110531091 NA coding upstream 385043 39050749 ~ 39053399 (-)
slc22a16 LOC106571810 coding upstream 1293663 39956961 ~ 40017167 (-)
LOC110530919 cdc40 coding upstream 1466485 40132191 ~ 40164976 (-)
G705135 NA non-coding downstream 7810 38657369 ~ 38657680 (-)
G704877 NA non-coding downstream 349475 38315706 ~ 38316015 (-)
G704862 NA non-coding downstream 369429 38295787 ~ 38296061 (-)
G704855 NA non-coding downstream 384481 38280711 ~ 38281009 (-)
G704800 NA non-coding downstream 385955 38192006 ~ 38279535 (-)
G705254 NA non-coding upstream 75636 38741342 ~ 38741544 (-)
G705261 NA non-coding upstream 80170 38745876 ~ 38746078 (-)
G705266 NA non-coding upstream 83308 38749014 ~ 38749394 (-)
G705271 NA non-coding upstream 88216 38753922 ~ 38754140 (-)
G705292 NA non-coding upstream 98875 38764581 ~ 38767389 (-)
G704874 NA other downstream 351687 38313489 ~ 38313803 (-)
G704702 NA other downstream 627144 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 1173333 37474229 ~ 37626960 (-)
LOC110529880 LOC106571768 other downstream 1303897 37355096 ~ 37361922 (-)
G701618 LOC106571560 other downstream 2747315 35900623 ~ 35918175 (-)
G706683 stxbp5 other upstream 553938 39219644 ~ 39226313 (-)
G709272 NA other upstream 4054065 42719771 ~ 42720699 (-)
G709454 NA other upstream 4505054 43170760 ~ 43171082 (-)
G711133 NA other upstream 5873087 44538793 ~ 44539504 (-)

Expression


G705145 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G705145 Expression in each Bioproject

Bar chart with 16 bars.
G705145 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network