G706800



Basic Information


Item Value
gene id G706800
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 39396810 ~ 39397157 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU803805
gtggaacgacatttattggatatttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagaatccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaaatttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU803805 True 348 lncRNA 0.43 1 39396810 39397157
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531091 NA coding downstream 343411 39050749 ~ 39053399 (-)
LOC118965515 NA coding downstream 572765 38822129 ~ 38826089 (-)
LOC110530913 NA coding downstream 594858 38787513 ~ 38801952 (-)
trnal-uaa-3 NA coding downstream 956530 38440198 ~ 38440280 (-)
LOC110529893 LOC106571757 coding downstream 1009502 38330693 ~ 38387308 (-)
slc22a16 LOC106571810 coding upstream 562212 39956961 ~ 40017167 (-)
LOC110530919 cdc40 coding upstream 735034 40132191 ~ 40164976 (-)
LOC118965516 LOC106588149 coding upstream 746754 40143911 ~ 40145193 (-)
armc2 armc2 coding upstream 1241114 40638271 ~ 40669501 (-)
LOC110529912 LOC106571799 coding upstream 1327240 40724397 ~ 40779631 (-)
G706797 NA non-coding downstream 7282 39389282 ~ 39389528 (-)
G706703 NA non-coding downstream 151378 39245066 ~ 39245432 (-)
G706700 NA non-coding downstream 155698 39240863 ~ 39241112 (-)
G705292 NA non-coding downstream 629421 38764581 ~ 38767389 (-)
G706816 NA non-coding upstream 30992 39428149 ~ 39428369 (-)
G706817 NA non-coding upstream 31214 39428371 ~ 39428714 (-)
G706818 NA non-coding upstream 33084 39430241 ~ 39430460 (-)
G706823 NA non-coding upstream 39373 39436530 ~ 39436739 (-)
G706834 NA non-coding upstream 57039 39454196 ~ 39454414 (-)
G706683 stxbp5 other downstream 170497 39219644 ~ 39226313 (-)
G704874 NA other downstream 1083007 38313489 ~ 38313803 (-)
G704702 NA other downstream 1358464 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 1904653 37474229 ~ 37626960 (-)
LOC110529880 LOC106571768 other downstream 2035217 37355096 ~ 37361922 (-)
G709272 NA other upstream 3322614 42719771 ~ 42720699 (-)
G709454 NA other upstream 3773603 43170760 ~ 43171082 (-)
G711133 NA other upstream 5141636 44538793 ~ 44539504 (-)
G712814 NA other upstream 6060620 45457777 ~ 45458248 (-)

Expression


G706800 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G706800 Expression in each Bioproject

Bar chart with 20 bars.
G706800 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network