G706816



Basic Information


Item Value
gene id G706816
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 39428149 ~ 39428369 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU803821
gcctggtggttcctgtggcagccccacacaccaggatgtctctctgtctcctccctgcaggtggtcctgtctgtccggcgccgctgccggagtctcccgcctgtccggcgccgctgccggagtctcccgcctgtccggcgccgctgccggagtctcccgcctgtccggcgccgctgccggagcctcccgcctgtccggcgccgctgccggagcctcccgcc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU803821 True 221 lncRNA 0.76 1 39428149 39428369

Neighbor


gene id symbol gene type direction distance location
LOC110531091 NA coding downstream 374750 39050749 ~ 39053399 (-)
LOC118965515 NA coding downstream 604104 38822129 ~ 38826089 (-)
LOC110530913 NA coding downstream 626197 38787513 ~ 38801952 (-)
trnal-uaa-3 NA coding downstream 987869 38440198 ~ 38440280 (-)
LOC110529893 LOC106571757 coding downstream 1040841 38330693 ~ 38387308 (-)
slc22a16 LOC106571810 coding upstream 531000 39956961 ~ 40017167 (-)
LOC110530919 cdc40 coding upstream 703822 40132191 ~ 40164976 (-)
LOC118965516 LOC106588149 coding upstream 715542 40143911 ~ 40145193 (-)
armc2 armc2 coding upstream 1209902 40638271 ~ 40669501 (-)
LOC110529912 LOC106571799 coding upstream 1296028 40724397 ~ 40779631 (-)
G706800 NA non-coding downstream 30992 39396810 ~ 39397157 (-)
G706797 NA non-coding downstream 38621 39389282 ~ 39389528 (-)
G706703 NA non-coding downstream 182717 39245066 ~ 39245432 (-)
G706700 NA non-coding downstream 187037 39240863 ~ 39241112 (-)
G706817 NA non-coding upstream 2 39428371 ~ 39428714 (-)
G706818 NA non-coding upstream 1872 39430241 ~ 39430460 (-)
G706823 NA non-coding upstream 8161 39436530 ~ 39436739 (-)
G706834 NA non-coding upstream 25827 39454196 ~ 39454414 (-)
G706837 NA non-coding upstream 30243 39458612 ~ 39458824 (-)
G706683 stxbp5 other downstream 201836 39219644 ~ 39226313 (-)
G704874 NA other downstream 1114346 38313489 ~ 38313803 (-)
G704702 NA other downstream 1389803 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 1935992 37474229 ~ 37626960 (-)
LOC110529880 LOC106571768 other downstream 2066556 37355096 ~ 37361922 (-)
G709272 NA other upstream 3291402 42719771 ~ 42720699 (-)
G709454 NA other upstream 3742391 43170760 ~ 43171082 (-)
G711133 NA other upstream 5110424 44538793 ~ 44539504 (-)
G712814 NA other upstream 6029408 45457777 ~ 45458248 (-)

Expression


G706816 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G706816 Expression in each Bioproject

Bar chart with 18 bars.
G706816 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network