G707137



Basic Information


Item Value
gene id G707137
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 39902621 ~ 39903101 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU804148
gttaagaacacgttcttattttcaatgacgttctaggaacggtgggttaactgcctcgtccaggggcagaacgacagattttcaccttgtcagctcgggggatccaatcttgcaaccttacagttaactagtccaacgcaataacgacctgcctctctcttgttgcactccacaaggagactgcctgttacgcaaatgcagtaagtcaaggtaagttgctagctatcattaaacttatcttataaaaaacaatcaatcataatcactagttaactacacacggttgatgatattactagatattatctagcgtgtcctgtgttgcatataatctgactgagcatacaagcatacaagtatctaagtatctgattgagcggtggtaggcagaagcaggcgcgtaaacattcattcaaacagcacttttgtgcgttttgccagcagctcttcattgtgcatcaagcattgcgctgtttttgac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU804148 True 481 lncRNA 0.42 1 39902621 39903101
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110531091 NA coding downstream 849222 39050749 ~ 39053399 (-)
LOC118965515 NA coding downstream 1078576 38822129 ~ 38826089 (-)
LOC110530913 NA coding downstream 1100669 38787513 ~ 38801952 (-)
trnal-uaa-3 NA coding downstream 1462341 38440198 ~ 38440280 (-)
LOC110529893 LOC106571757 coding downstream 1515313 38330693 ~ 38387308 (-)
slc22a16 LOC106571810 coding upstream 56268 39956961 ~ 40017167 (-)
LOC110530919 cdc40 coding upstream 229090 40132191 ~ 40164976 (-)
LOC118965516 LOC106588149 coding upstream 240810 40143911 ~ 40145193 (-)
armc2 armc2 coding upstream 735170 40638271 ~ 40669501 (-)
LOC110529912 LOC106571799 coding upstream 821296 40724397 ~ 40779631 (-)
G707130 NA non-coding downstream 7810 39894479 ~ 39894811 (-)
G707119 NA non-coding downstream 12438 39889955 ~ 39890183 (-)
G707118 NA non-coding downstream 13214 39889178 ~ 39889407 (-)
G707065 NA non-coding downstream 64109 39837173 ~ 39838512 (-)
G707018 NA non-coding downstream 106415 39794248 ~ 39796206 (-)
G707140 NA non-coding upstream 4304 39907405 ~ 39907688 (-)
G707129 NA non-coding upstream 17395 39920496 ~ 39921996 (-)
G707168 NA non-coding upstream 121288 40024389 ~ 40024636 (-)
G707234 NA non-coding upstream 199499 40102600 ~ 40104160 (-)
G707316 NA non-coding upstream 361436 40264537 ~ 40269554 (-)
G706683 stxbp5 other downstream 676308 39219644 ~ 39226313 (-)
G704874 NA other downstream 1588818 38313489 ~ 38313803 (-)
G704702 NA other downstream 1864275 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 2410464 37474229 ~ 37626960 (-)
LOC110529880 LOC106571768 other downstream 2541028 37355096 ~ 37361922 (-)
G709272 NA other upstream 2816670 42719771 ~ 42720699 (-)
G709454 NA other upstream 3267659 43170760 ~ 43171082 (-)
G711133 NA other upstream 4635692 44538793 ~ 44539504 (-)
G712814 NA other upstream 5554676 45457777 ~ 45458248 (-)

Expression


G707137 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G707137 Expression in each Bioproject

Bar chart with 20 bars.
G707137 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network