G707366



Basic Information


Item Value
gene id G707366
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 40346846 ~ 40347214 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU804383
cacttaaggagtgttgtatggcattgaagcttgtctggaggtttgttaacacagtttccaaagaagggccagatttatacagaatggtgtcgtctgcatagaagtggatcagagaatcaccagcagcaagagcgacatcattgatatatacagagaaaagagtcggcccgagaattgaaccctgtggcacctccatagagactgccagaggtccagacaacaggccctccgatttgacacactgaactctatctgagaagtagttggtaaaccaggcgaggcagtcatttgagaaaccaaggctgttgagtctgctgataagaatgaagtgacagagtcgaaagccttggccaggtcgatgaagacgga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU804383 True 369 lncRNA 0.47 1 40346846 40347214
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530919 cdc40 coding downstream 181870 40132191 ~ 40164976 (-)
LOC118965516 LOC106588149 coding downstream 201653 40143911 ~ 40145193 (-)
slc22a16 LOC106571810 coding downstream 329679 39956961 ~ 40017167 (-)
LOC110531091 NA coding downstream 1293447 39050749 ~ 39053399 (-)
LOC118965515 NA coding downstream 1522801 38822129 ~ 38826089 (-)
armc2 armc2 coding upstream 291057 40638271 ~ 40669501 (-)
LOC110529912 LOC106571799 coding upstream 377183 40724397 ~ 40779631 (-)
LOC118965517 NA coding upstream 432637 40779851 ~ 40800037 (-)
LOC110529916 LOC106571797 coding upstream 610928 40958142 ~ 40969478 (-)
LOC118965611 NA coding upstream 1378307 41725469 ~ 41728987 (-)
G707362 NA non-coding downstream 6177 40340446 ~ 40340669 (-)
G707316 NA non-coding downstream 77292 40264537 ~ 40269554 (-)
G707234 NA non-coding downstream 242686 40102600 ~ 40104160 (-)
G707168 NA non-coding downstream 322210 40024389 ~ 40024636 (-)
G707129 NA non-coding downstream 424850 39920496 ~ 39921996 (-)
G707374 NA non-coding upstream 10135 40357349 ~ 40357567 (-)
G707408 NA non-coding upstream 76940 40424154 ~ 40424902 (-)
G707413 NA non-coding upstream 86830 40434044 ~ 40434294 (-)
G707422 NA non-coding upstream 99581 40446795 ~ 40447175 (-)
G707488 NA non-coding upstream 121612 40468826 ~ 40469059 (-)
G706683 stxbp5 other downstream 1120533 39219644 ~ 39226313 (-)
G704874 NA other downstream 2033043 38313489 ~ 38313803 (-)
G704702 NA other downstream 2308500 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 2854689 37474229 ~ 37626960 (-)
G709272 NA other upstream 2372557 42719771 ~ 42720699 (-)
G709454 NA other upstream 2823546 43170760 ~ 43171082 (-)
G711133 NA other upstream 4191579 44538793 ~ 44539504 (-)
G712814 NA other upstream 5110563 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 5963916 46309732 ~ 46325685 (-)

Expression


G707366 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G707366 Expression in each Bioproject

Bar chart with 20 bars.
G707366 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network