G707488



Basic Information


Item Value
gene id G707488
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 40468826 ~ 40469059 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU804515
cccaataggtccacagacgacgcaatcacactgcacactgccctaacccatctggacaagaggaatacctatgtaagaatgctgttcatcaactacagctcagcgtctaacaccatagtaccctctaaactcgtcattaagctcgagaccctgggtctcgaccccgccctgtgcaactgggtcctggacttcctgactggccgccaccaggtggtgagggtaggtaacaacatc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU804515 True 234 lncRNA 0.53 1 40468826 40469059
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110530919 cdc40 coding downstream 303850 40132191 ~ 40164976 (-)
LOC118965516 LOC106588149 coding downstream 323633 40143911 ~ 40145193 (-)
slc22a16 LOC106571810 coding downstream 451659 39956961 ~ 40017167 (-)
LOC110531091 NA coding downstream 1415427 39050749 ~ 39053399 (-)
LOC118965515 NA coding downstream 1644781 38822129 ~ 38826089 (-)
armc2 armc2 coding upstream 169212 40638271 ~ 40669501 (-)
LOC110529912 LOC106571799 coding upstream 255338 40724397 ~ 40779631 (-)
LOC118965517 NA coding upstream 310792 40779851 ~ 40800037 (-)
LOC110529916 LOC106571797 coding upstream 489083 40958142 ~ 40969478 (-)
LOC118965611 NA coding upstream 1256462 41725469 ~ 41728987 (-)
G707422 NA non-coding downstream 21651 40446795 ~ 40447175 (-)
G707413 NA non-coding downstream 34532 40434044 ~ 40434294 (-)
G707408 NA non-coding downstream 43924 40424154 ~ 40424902 (-)
G707374 NA non-coding downstream 111259 40357349 ~ 40357567 (-)
G707366 NA non-coding downstream 121612 40346846 ~ 40347214 (-)
G707497 LOC106613263 non-coding upstream 15991 40485050 ~ 40485380 (-)
G707505 NA non-coding upstream 28991 40498050 ~ 40499490 (-)
G707485 NA non-coding upstream 43055 40512114 ~ 40516751 (-)
G707520 NA non-coding upstream 53225 40522284 ~ 40522521 (-)
G707801 NA non-coding upstream 166395 40635454 ~ 40636067 (-)
G706683 stxbp5 other downstream 1242513 39219644 ~ 39226313 (-)
G704874 NA other downstream 2155023 38313489 ~ 38313803 (-)
G704702 NA other downstream 2430480 38037725 ~ 38038346 (-)
LOC110530908 otof other downstream 2976669 37474229 ~ 37626960 (-)
G709272 NA other upstream 2250712 42719771 ~ 42720699 (-)
G709454 NA other upstream 2701701 43170760 ~ 43171082 (-)
G711133 NA other upstream 4069734 44538793 ~ 44539504 (-)
G712814 NA other upstream 4988718 45457777 ~ 45458248 (-)
crfb16 LOC106568648 other upstream 5842071 46309732 ~ 46325685 (-)

Expression


G707488 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G707488 Expression in each Bioproject

Bar chart with 20 bars.
G707488 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network